Apr 28, 2026
CRISPR editing of LSD genes in H9-AAVS1-TRE3G-NGN2-TMEM192-3xHA cells
- Harper JW1,
- Yizhi Jiang1
- 1Harvard Medical School
Protocol Citation: Harper JW, Yizhi Jiang 2026. CRISPR editing of LSD genes in H9-AAVS1-TRE3G-NGN2-TMEM192-3xHA cells. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpmdwpgzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 04, 2025
Last Modified: April 28, 2026
Protocol Integer ID: 226461
Keywords: Electroporation, Cas9, Cas9 protein, hPSCs, human pluripotent stem cells, ASAPCRN, crispr editing, gene, lysosomal storage disorder, LSD, crispr editing of lsd gene, lsd gene, crispr editing, lysosomal storage disorder, 3xha cells this protocol, 3xha cell, lsd, gene, cas9
Funders Acknowledgements:
asap
Grant ID: 000282
asap
Abstract
This protocol describes a method for making single knock out of 23 genes involved in lysosomal storage disorders (LSD) in H9-AAVS1-TRE3G-NGN2-TMEM192-3xHA cells using either Cas9 or Cpf1 and electroporation with a NEON system.
Attachments
Materials
Materials
Cells employed: H9-AAVS1-TRE3G-NGN2-TMEM192-3xHA cells
Electroporation kit: Neon Transfection Kit (Invitrogen, MPK1096B)
Reagents
| Y-27632 Dihydrochloride (ROCK inhibitor) | Biozol | S1049 |
Gene editing enzyme
| Cas9-NLS | QB3 MacroLab; UC Berkeley |
gRNA synthesis
| GeneArt Precision gRNA Synthesis Kit | Thermo Fisher Scientific | A29377 |
Oligonucleotides
| A | B | C | |
| ASAH1 | tgctgttaagactttgcctctc | catcatagcataccactggtgc | |
| ATP13A2 | cagacaccccaacttcctactc | atttcgataacgagtgtttcgg | |
| CLN3 | ttggacactctatgaccctgg | gagtcagctctcattcccctc | |
| CLN5 | gaggctccggaagtactgg | gcactcacttgtagggcacc | |
| CLN6 | cacctcgacctctggttctact | ggccaagtcatagagctaagga | |
| CLN8 | gtgcagtctttggtgttcagag | caaatgtccggaagatcaagtt | |
| CTSD | aggagtttggttttggctgtg | catgtagttcttgagcacctcg | |
| CTSF | ctcacctactcctctctccagg | catcatccaactgctgctttac | |
| DNAJC5 | ttctgctgagggcatttggg | cgtagaactccgtctcctcg | |
| GAA | tcctactccatgatttcctgct | cctgctttgcagggatgtag | |
| GBA1 | ccagtgttgcgcctttgtctct | cactcacctgaagtggccaagg | |
| GRN | gctggtagtatcctgggtcatc | aaaatggtcctgactccgtct | |
| HEXA | tggcctcagaacttccaaac | actcacctgtgaggtaaggacg | |
| HEXB | aaatatgtttgcttgcaggatg | aaatgctaagtcacagccaaaa | |
| LIPA | caatttccatcgtcctttttct | tgcaaacctcaacacagttagtg | |
| MCOLN1 | ctctcctattcccacagagacc | atcttgaccacttgcagcatc | |
| MFSD8 | tgttttgccagcttcacgcc | ccaacagcgcaggagactga | |
| NPC1 | accattgagaccctggtaacac | gtcatatccatcctttggcaat | |
| NPC2 | ccccgacaggtttgtcttgt | cgggaaccttgggcgg | |
| PPT1 | tcatgtgacacagcgaagatg | ctaggaagagagagaatcgcca | |
| PSAP | ctcctcacgttggttttcattt | ttacagctgttctaaggggacc | |
| SMPD1 | tcacagcacttgtgaggaagtt | tcccttcactttcattcacctt | |
| TPP1 | aagcctggtgagaaattgagag | agaagctaggaccaggacagtg |
Safety warnings
For hazard information and safety warnings, please refer to the SDS (Safety Data Sheet).
Before start
Use ThermoFisher Kit to directly electroporate ESCs with Cas9 protein and sgRNA.
Works better than plasmid transfection.
Add 10 µL buffer R to a sterile 1.5 ml tube. Add 6 µg purified Cas9 or Cpf1 protein (2mg/ml) . Then add 1.2 µg sgRNA Pipet up and down to mix. Let it sit at Room temperature for 00:10:00 . This is enough for 2 transfections (== two 24 well). Buffer R is a reagent in the electroporation kit: Neon Transfection Kit (Invitrogen, MPK1096B).
10m
sgRNA target sequences (including PAM)19 steps
| ASAH1 | ttta tggtgtaccatggaactgcacctc | |
| ATP13A2 | tccgttggaagcccctgtgg ggg | |
| CLN3 | gggcgggaatactcaccct cgg | |
| CLN5 | ggcgctgctttggctcg cgg | |
| CLN6 | tttc acactcaccatggcaatgggacgc | |
| CLN8 | tttc acatcacgacagcaacgggattct | |
| CTSD | caacctccgacatggtccgg cgg | |
| CTSF | accatggggtcgttgcaggg tgg | |
| DNAJC5 | gaggccgcagaagacaaaca ggg | |
| GAA | actcacccagctcaccagca ggg | |
| GBA1 | accccgaaggaggacccaat tgg | |
| GRN | tcgaccataacacagcacg tgg | |
| HEXA | cggccgagctgacatcgtac tgg | |
| HEXB | gaaaagtgatgctctgatat ggg | |
| LIPA | ttaaccgaattcctcatggg agg | |
| MCOLN1 | cttggctcgaaacttgtcgc agg | |
| MFSD8 | cctgcggaacgaaagtgaac agg | |
| NPC1 | tttg gtatggagagtgtggaattgcata | |
| NPC2 | agctgccaggaaacgcatcg cgg | |
| PPT1 | atcccatgccagatcaccaa cgg | |
| PSAP | tggactgaaagaatgcacca ggg | |
| SMPD1 | gcttcatagagccagcggg agg | |
| TPP1 | agtcaactcacgtcctccgc tgg |
Employ Geneart Precision gRNA Synthesis kit according to manufacturer instructions (Thermo Fischer, A29377)
Use the following primers together with Tracr Fragment PCR template for PCR
Forward: 5'-TAATACGACTCACTATAGAGTAGAACGTGAGAGGCTCA
Reverse: 5'-TTCTAGCTCTAAAACTGAGCCTCTCACGTTCTACT
While waiting for the Cas9 to bind to sgRNA, individualize H9-AAVS1-TRE3G-NGN2-TMEM192-3xHA cells with Accutase. Neutralize Accutase with 5x volume E8 with Rock inhibitor.
Count cells. You will need 2x105 for each transfection.
Spin down cells. Let it sit for a while so all the residue media can go down to the bottom of the tube. If the residue media is too much, take it out with a P200 pipet.
Resuspend cells to a concentration of 2x105 per 5 μl (ie 4x107 per ml) using buffer R.
Note
You don’t have to take all the residue media off but you will need to take into account the volume of residue media so you are not too much off.
Prepare a 24 well matrigel coated plate. Add 0.5 mL -1 mL E8+ rock inhibitor (1:1000) to the wells you will use. Add Human Serum Albumin (1:2500) to each well. Each transfection goes into one well. Typically, we perform 2-3 transfections per gRNA-Cas9 complex.
Wipe the Neon pipet station with EtOH and place it inside the hood.
Add 3 mL electrolytic buffer (buffer E) to the neon tube. Place the tube inside the station. You should feel a click before the tube is securely seated in the station.
Use program 13 from the optimization tab for electroporation parameter. Program 9 should also work.
When everything is ready, mix 10 µL -11 µL of resuspended cells with the Cas9 (or Cpf1)+RNA containing R buffer. The final volume should be in the range of 21 µL -22 µL .
Take up a NEON tip, pipet 10 µL cell protein mix and electroporate with program 13.
Note
It is important to pipet slowly to avoid air bubble formation. It is also important to insert the pipet slowly into the station, especially during the end of the insertion when you will feel a click. I normally help the pipet down slowly during the clicking so there is no sudden movement of the tip, which might create tiny air bubbles.
If you see air bubble in the tip, take it out, push everything out of the tip and re-pipet the mixture.
If you see sparking during the electroporation, your efficiency will reduce significantly.
Once electroporation is complete, push everything into one well of a 24 well plate. Do not pipet up and down with Neon tip.
Repeat the same procedure with the same tip and the left over cell mixture. This is just a replicate.
Disperse cells evenly in the well and place cells in a low O2 incubator.
Put electroporated cells into low oxygen incubator for 2 days to help maintain viability.
Expansion of clones for analysis by Sequencing
Sort cells into single wells of 96 well plates and keep cells in E8 medium + 10% Clone R2 (STEMCELL Technologies), and put cells into a low-oxygen incubator for 3-4 days till colonies are visible under the microscope, then move cells to a regular incubator. Change media with regular E8 every other day.
10-14 days post sorting, split cells in 2 sets; 1 set for sequencing and the other for expansion. Keep cells in 10µM Rock inhibitor and 12.5µg/ml human serum albumin(HSA) while splitting. Consolidate cells while splitting if necessary.
Clone screening is done using PCR-based sequencing for the relevant mutant allele (primers are provided in Materials). PCR primers for each of the alleles targeted in this protocol are provided in the material section. Selected clones are validated by mass spectrometry.