Oct 28, 2024
CRISPR/Cas9 genome editing in Candida albicans
- Chien-Der Lee1,
- Alexander johnson1
- 1University of California San Francisco
- protocols.io Ambassadors
Protocol Citation: Chien-Der Lee, Alexander johnson 2024. CRISPR/Cas9 genome editing in Candida albicans. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl4we1rvo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 26, 2024
Last Modified: October 28, 2024
Protocol Integer ID: 110965
Keywords: cas9 genome editing in candida, cas9 genome editing, homozygous knockout strain in diploid candida albican, generated cas9, digested cas9, diploid candida albican, transient cas9 expression method, crispr, candida, homozygous knockout strain, genome, plasmid, modification, knockout strain, cas9
Abstract
This protocol aims to create a homozygous knockout strain in diploid Candida albicans, based primarily on the transient Cas9 expression method by Min et al. in mSphere (2016), with some modifications. Notably, it uses plasmid-digested Cas9 (pp2280) instead of PCR-generated Cas9, optimizing both time and cost. The knockout strain should be successfully obtained within one week of the transformation reaction.
Guidelines
This protocol combines the classic SAT1-Flipper system with Cas9-induced double-strand breaks to streamline the creation of homozygous knockouts in diploid Candida albicans.
Materials
pADH34_protocol_io.gbk18KB 
pp2280_protocol_io.gbk72KB Troubleshooting
Safety warnings
Due to the nature of the SAT1-Flipper system, the knockout strain will retain an FLP site scar. However, this scar can serve as a CRISPR/Cas9 target site for further modifications if needed.
Prepare for DNA required for transfomation
There are only three DNA components required for transformation:
- PENO1-Cas9-tCYC1 construct (StuI digested pp2280)
- PSNR52-gRNA-scaffold-terminator
- SAT1-Flipper donor DNA with homologous end
Component 1. PENO1-Cas9-tCYC1 construct (StuI digested pp2280)
This restriction enzyme digested fragment provides the transient Cas9 expression in Candida albicans without integrating into the genome, as it does not have homology sequence to the genome.
I modified the plasmid pADH140 (Aaron Hernday) to pp2280 (see materials) so that it can be digested by StuI for transient Cas9 expression.
Gel extraction after StuI digestion is optional.
Component 2. PSNR52-gRNA-scaffold-terminator
Two independent PCRs to amplify PSNR52-gRNA, and gRNA-scaffold-terminator from pADH143 (Aaron Hernday). Then followed by fusion PCR (alternatively, Gibson assembly or isothermal assembly also work) to fuse these two fragment together.
Component 3. SAT1-Flipper donor DNA with homologous end
PCR the classic SAT1-Flipper cassette with 80 bp flanking region to the targeted gene.
Note: Generally speaking, the longer the flanking region, the higher the knockout efficiency. 60~100 bp flanking region should all work.
Transformation
1w 2d
Streak out strain from -80˚C to YPD plate, 30˚C sit for 2 days
2d
Pick single colony and inoculate to 3 mL YPD, roller drum 30˚C O/N
1d
In the morning, back dilute the O/N culture to 10 mL YPD per transformation reaction (~0.2 OD/mL to
start). 30˚C 200rpm shaking in flask
About 3~4 hours, the cell density reaches to ~0.8 OD/mL
4h
Spin down the cell by 3000xg 2min, wash with 10 mL water, and then spin down again
10m
Resuspend all cell with: (all need to be sterilized)
| A | B | |
| 50 % PEG 3350 | 800 µL | |
| 1 M Lithium Acetate | 100 µL | |
| 10 mg/mL heat denatured salmon sperm DNA | 50 µL | |
| 10X TE pH 8.0 | 100 µL | |
| Component 1 | 50 µL | |
| Component 2 | 50 µL | |
| Component 3 | 50 µL |
44˚C heat shock for 15min (we use water bath here)
15m
Spin down cell at 3000xg 1min, wash twice with 1 mL YPD
10m
Resuspend all cell in 2 mL YPD, 30˚C roller drum for at least 4 hours (O/N is fine).
4h
Spin down all cell at 3000xg 1min, wash twice with water
10m
Resuspend all cell in 1 mL water and take 100 µL to YPD+NAT plate. 30˚C sit for >2days
2d
Pick several colonies to new YPD+NAT plate (Due to the high efficiency, 4 colonies should be enough)
Inoculate cells to 2 mL YP+2% maltose 30˚C O/N to Flip out SAT1 cassette
1d
Streak small amount of O/N culture to YPD. 30˚C sit for >2days
2d
Patch single colonies to YPD. Then test if it lack the NAT-resistance. (indicating the SAT1-Flipper has been removed)
1d
Store strains lacking NAT-resistance.
Appendix 1. PCR primer design information: Ade2 Knockout as an example
Component 2 PCR-A (PSNR52)
| A | B | |
| template | pADH143 | |
| F1 | catctaatcaactcccagat | |
| R1 | caaattaaaaatagtttacgcaag |
Component 2 PCR-B (gRNA-scaffold-terminator)
| A | B | |
| template | pADH143 | |
| F2 | cttgcgtaaactatttttaatttgCAACAATCATACGACCTAATgttttagagctagaaatagca | |
| R2 | taaaaaaaCTCGAGAAAAAAAGCAC |
F1, R1 and R2 are universal for different KO. Only F2 (contain gRNA) is gene specific
Component 2 PCR-C (fusion PCR of A and B)
This PCR product will be used for transformation)
| A | B | |
| template | PCR-A and PCR-B product, equal molar ratio (50ng each is good for 50 µL PCR reaction) | |
| F1 | catctaatcaactcccagat | |
| R2 | taaaaaaaCTCGAGAAAAAAAGCAC |
The PCR-A and PCR-B product need to be DpnI digested and PCR clean up to remove both the template plasmid and primers.
Make sure to use the correct primer pair here: F1 and R2
Component 3. Primer for SAT1-Flipper donor DNA with homologous end (pADH34 as template)
| A | B | |
| template | pADH34 (or any plasmid with SAT1-Flipper should work) | |
| F | AAAAAACAACCAACCAACCCTTAACCCATTAACGAATTAAGATTTGTTCTATTTGACTACCAAGAATATAACCCATATTActagtgaattcgcgctcgag | |
| R | TTCTTTTTATATATTAATTATAATTTTATTGCACCATAACGTTTACTTGTTTAATATGCTATTGATATCTATATTTTTTTcgctctagaactagtggatc |
Appendix 2. gRNA design
We design the gRNA using Benchling tools following the protocol in Nguyen et. al., mSphere 2017
Alternatively, Candida albicans gRNA sequence for each gene can be found in the supplementary information in Vyas et. al., Sci Adv. 2015
Protocol references
Vyas VK, Barrasa MI, Fink GR. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv. 2015;1(3):e1500248. doi: 10.1126/sciadv.1500248. PMID: 25977940; PMCID: PMC4428347.
Min K, Ichikawa Y, Woolford CA, Mitchell AP. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 2016 Jun 15;1(3):e00130-16. doi: 10.1128/mSphere.00130-16. PMID: 27340698; PMCID: PMC4911798.
Nguyen N, Quail MMF, Hernday AD. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2017 Apr 26;2(2):e00149-17. doi: 10.1128/mSphereDirect.00149-17. PMID: 28497115; PMCID: PMC5422035.
Acknowledgements
We thank Aaron Hernday for providing the plasmids, Manning Huang and Carrie Graham for helpful discussion.