CRAC Analysis in Budding Yeast with HTP Tagged Proteins

Rosey Bayne; Stefan  Bresson; David Tollervey; Edward Wallace

Sep 25, 2020

CRAC Analysis in Budding Yeast with HTP Tagged Proteins

DOI

dx.doi.org/10.17504/protocols.io.5ppg5mn

Rosey Bayne¹,
Stefan Bresson²,
David Tollervey²,
Edward Wallace¹

¹School of Biological Sciences, University of Edinburgh;
²Wellcome Centre for Cell Biology, University of Edinburgh

Wallace lab for Fungal RNA
Yeast Protocols, Tools, and Tips

Rosey Bayne

DOI: dx.doi.org/10.17504/protocols.io.5ppg5mn

External link: https://doi.org/10.1093/nar/gkab615

Protocol Citation: Rosey Bayne, Stefan Bresson, David Tollervey, Edward Wallace 2020. CRAC Analysis in Budding Yeast with HTP Tagged Proteins. protocols.io https://dx.doi.org/10.17504/protocols.io.5ppg5mn

Manuscript citation:

Bayne RA,  Jayachandran U,  Kasprowicz A,  Bresson S,  Tollervey D,  Wallace EWJ,  Cook A, Yeast Ssd1 is a non-enzymatic member of the RNase II family with an alternative RNA recognition site. Nucleic Acids Research  50(5). doi: 10.1093/nar/gkab615

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it works well for us.

Created: July 22, 2019

Last Modified: September 28, 2020

Protocol Integer ID: 26063

Keywords: HTP tag, Cross-linking, budding yeast, CRAC

Disclaimer

DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.

Abstract

CRAC (Cross-linking and cDNA Analysis) is a method that uses UV-crosslinking to identify which RNAs bind to an RNA-Binding Protein of interest and the specific sites in the RNA where this binding occurs. CRAC is one of the family of UV crosslinking and immunoprecipitation (CLIP) protocols, reviewed by Lee and Ule (DOI: 0.1016/j.molcel.2018.01.005).The protein is tagged with with a tandem affinity tag:  in this protocol we use an HTP tag (His6-TEV-ProteinA) that allows immuno-affinity purification of the protein with its cross-linked RNAs by binding of the ProteinA moiety of the tag to IgG Sepharose columns. After washing, the protein is then released from the column by cleavage with TEV protease and subjected to  nickel-affinity purification through the His6 moiety under highly denaturing conditions. This allows accurate mapping of RNA binding sites (Bohnsack, et al, DOI: 10.1016/B978-0-12-396546-2.00013-9) ; Granneman, S. et al (DOI: 10.1073/pnas.0901997106 ). The protocol can also be adapted for use with  HTF (His6-TEV-FLAG3) tags (Tree, J.J. et al,  DOI: 10.1016/j.molcel.2014.05.006) or HF (His8-Ala4-FLAG) tags (Bresson, S., Shchepachev, V., Spanos, C., Turowski, T., Rappsilber, J. and Tollervey, D.(2020): DOI: /10.1101/2020.05.14.096354) by replacing the IgG sepharose column with anti-FLAG magnetic beads and elution with excess FLAG peptide, removing the need for TEV cleavage which can be inefficient. The cDNA libraries generated allow a transcriptome -wide analysis of the interactome of the protein.

Materials

MATERIALS
ReagentT4 RNA Ligase 1 (ssRNA Ligase) - 5,000 unitsNew England BiolabsCatalog #M0204L 
ReagentRNase H - 250 unitsNew England BiolabsCatalog #M0297S 
ReagentMinElute PCR Purification KitQiagenCatalog #28004 
ReagentrATP (100mM), 400ulPromegaCatalog #E6011 
ReagentHaloTEV Protease, 200 ulPromegaCatalog #G6601 
ReagentTSAP Thermosensitive Alkaline Phosphatase, 100uPromegaCatalog #M9910 
ReagentRNasin(R) RNase Inhibitor 10,000uPromegaCatalog #N2115 
ReagentRecombinant RNasin(R) RNase Inhibitor, 2,500uPromegaCatalog #N2511 
ReagentNUPAGE LDS sample buffer (4x)Thermo Fisher ScientificCatalog #NP0007 
Reagent1x NUPAGE MOPS SDS running buffer (20x)Thermo Fisher ScientificCatalog #NP0001 
ReagentT4 Polynucleotide Kinase - 2,500 unitsNew England BiolabsCatalog #M0201L 
ReagentGeneRuler 50 bp DNA LadderThermo Fisher ScientificCatalog #SM0371 
ReagentYNB - w/o amino acidsFormediumCatalog #CYN0405 
ReagentCSM-TRPFormediumCatalog #DCS0149 
ReagentMillipore MF-Membrane Filters 0.45um HAMerck MilliporeSigma (Sigma-Aldrich)Catalog #HAWP09000 
Reagent0.5mm Zirconia BeadsThistle ScientificCatalog #11079105Z 
Reagentcomplete ULTRA Mini EDTA-free Protease Inhibitor Cocktail Tablets in blister packsMerck MilliporeSigma (Sigma-Aldrich)Catalog #5892791001 
Reagent1.5ml Safe-lock tubesEppendorfCatalog #0030120086 
ReagentIgG Sepharose 6 Fast Flow GE HealthcareMerck MilliporeSigma (Sigma-Aldrich)Catalog #17-0969-01 
ReagentPierce™ Spin Columns - Snap CapThermo Fisher ScientificCatalog #69725 
ReagentGuanidine  hydrochlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #G4505 
ReagentRNace-It Ribonuclease Cocktail Agilent TechnologiesCatalog #400720 
ReagentImidazole anhydrousMerck MilliporeSigma (Sigma-Aldrich)Catalog #792527 
ReagentNi-NTA Superflow Beads (25 ml)QiagenCatalog #30410 
ReagentTSAP Thermo-sensitive Alkaline PhosphatasePromegaCatalog #M9910 
ReagentT4 RNA Ligase 1 New England BiolabsCatalog #M0204L 
ReagentT4 RNA Ligase II truncated K227QNew England BiolabsCatalog #M0351S/ M0351L 
ReagentT4 Poynucleotide KinaseNew England BiolabsCatalog #M0201L 
Reagent32P-γATPPerkin ElmerCatalog #NEG502Z-250/ NEG502Z-500 
ReagentrATP 100mMPromegaCatalog #E6011 
ReagentNuclease-free waterCatalog #AM9937 
ReagentGlycoBlue CoprecipitantLife TechnologiesCatalog #AM9516 
ReagentNuPAGE LDS sample buffer 4×Life TechnologiesCatalog #NP0007 
ReagentNuPAGE 4–12% (wt/vol) polyacrylamide Bis-Tris gelsLife TechnologiesCatalog #NP0335 
ReagentNuPAGE SDS-MOPS running bufferLife TechnologiesCatalog #NP0001 
ReagentSeeBlue Plus2 pre-stained standardLife TechnologiesCatalog #LC5925 
ReagentPrestained Protein Ladder – Broad molecular weight (10-245 kDa)AbcamCatalog #ab116028 
ReagentHybond-C Extra membraneFisher ScientificCatalog #10564755 
ReagentNuPage transfer bufferLife TechnologiesCatalog #NP00061 
ReagentRabbit anti-TAP Tag Polyclonal AbThermofisherCatalog #CAB1001 
ReagentKodak BioMax MS autoradiography filmMerck MilliporeSigma (Sigma-Aldrich)Catalog #8222648 
ReagentDonkey anti-Rabbit IgG Dylight680 AntibodyThermofisherCatalog #SA5-10042 
ReagentProteinase KRocheCatalog #03115836001 
ReagentDeoxynucleoside Triphosphate Set (lithium salt)RocheCatalog #11277049001 
ReagentSuperscript IV Reverse TranscriptaseLife TechnologiesCatalog #18090050 
ReagentRNase HNew England BiolabsCatalog #M0297L 
ReagentTaKaRa long and accurate (LA) TaqTakara Bio Inc.Catalog #RR002M 
ReagentMetaphor Agarose LonzaCatalog #LZ50181 
Reagent	SYBR™ Safe DNA Gel StainThermo Fisher ScientificCatalog #S33102 
ReagentNew 6x Purple Loading DyeNew England BiolabsCatalog #B7024S 
Reagent50bp DNA LadderNew England BiolabsCatalog #N3236S 
ReagentMinElute Gel extraction kitQiagenCatalog #28604 
ReagentQubit™ dsDNA HS Assay Kit Catalog #Q32851 
ReagentIllumina MiniSeq High Output Reagent Kit Illumina, Inc.Catalog #FC-420-1001 
ReagentMonoclonal M2 antibody (anti-FLAG)Merck MilliporeSigma (Sigma-Aldrich)Catalog #F1804-200UG 

Safety warnings

A number of the Buffers used in this protocol include 2-mercaptoethanol which is toxic. Always dispense from the stock bottle in the fume hood.

This protocol uses a  radio-active substance and some stages must be performed in a room suitable for such work according to Local and State Health and Safety Regulations by a person suitably trained for such purposes.

Before start

Check you have all of the reagents and buffers you will need. Be prepared for some long days.

Yeast Culture Day 1

Autoclave Amount2 L   milliQ water per CRAC sample in 5 litre flasks. For each flask prepareAmount286 mL   each of sterile 10x Yeast Nitrogen Base without Amino Acids (YNB-aas; Formedium), 10x Complete Synthetic Medium - Tryptophan (CSM -TRP; Formedium) and 20% glucose. These will be combined at Step 3 to make Synthetic Minimal Medium - Tryptophan (SMM - TRP).  
Note
SMM - TRP is used because Tryptophan absorbs UV light at 280nm and so reduces the efficiency of UV cross-linking.


 Pre-warm all to Temperature30 °C   DurationOvernight  . 

Grow yeast strains in 50 ml pre-made SMM-TRP at Temperature30 °C    DurationOvernight  . Set-up up to 3 yeast cultures, each in  50 ml SMM-TRP or 100ml for 2 technical replicates (for control and +heatshock samples).

Yeast Culture Day 2, and Heat-shock

Mix the large volume pre-warmed SMM media components from Step1 with the water in each flask and inoculate with yeast from the starter cultures to give a starting density of ~0.070 x107 cells/ml (OD600 ~0.05 for the first culture, OD600 ~0.035 for the 2nd and OD600 ~0.025 for the third to allow time to process each culture and cross-link). Shake each at Temperature30 °C    until OD600 ~ 0.5 (~Duration08:00:00   ) - there should be around 45 mins between each culture being ready. Expect to get ~ 1g of cells/L of culture. Prechill as many tubes containing 50ml of PBS to allow 1 tube per culture plus another 2 empty tubes per culture and pre-chillTemperatureOn ice   .

Cultures to be exposed to heat shock are rapidly collected onto 0.45µm MF-membrane filters (Millipore; or 0.8µm to reduce clogging) by vacuum filtration and the filter + cells transferred into a fresh 2.858ml of SMM-TRP medium pre-warmed to 42°C and incubated for exactly Duration00:16:00   at Temperature42 °C  , followed immediately by cross-linking. Control samples not subjected to heatshock can be cross-linked immediately.

UV Crosslinking (per sample)

30m

UV crosslinking using the Megatron (UVO3: see Bohnsack Tollervey & Granneman (2012) Methods in Enzymology  511, 275-288)): Wash the Megatron tube once with de-ionised water, being careful to avoid spilling anything on the UV lamp. On the second wash with water, close the tap and screw on the the lid on the Megatron tube. Turn on the middle lamp first and then the one directly underneath the tube. The lid should begin to slowly turn green. You should be able to see blue light if you look through the window on the Megatron to the lamp. Continue until the lamp has gone past 100%. Switch off the lamps (middle one first). Set timer for 100s and pour in the culture. Turn on middle lamp, lower lamp, and immediately start timer. Tip the apparatus back and forth to mix cells across the  light. Turn lamps off once time has expired. Open the tap on the Megatron and collect the irradiated culture into a large beaker. Collect the irradiated cells onto 0.45µm or 0.8µm MF-membrane filters by filtration. Transfer the cells + filter to a 50ml tube of pre-chilled PBS on ice, close the lid,  tip  the tube back and forth to release the cells and then remove the filter. Transfer 1/3 of the cells into each of the 2 further pre-chilled Falcon tubes and spin atCentrifigation3000 x g, 4°C, 00:05:00   in a benchtop centrifuge. Pour off the supernatent, drain residual liquid from the tubes by decapping and briefly turning upside down on paper towels. Replace the caps on  the tubes of cell pellets and then freeze them on dry ice before storing at -80°C. Meanwhile, wash the Megatron with water between samples and do a final rinse with 70% ethanol and allow to evaporate after the last sample.

Lysis

1h 25m

Add 1V (~ 1.0 ml/pellet from 1L of cells ) of TN150plus (50mM Tris.HCl, pH7.8/ 150mM NaCl/ 0.1% NP-40 /5 mM 2-Mercaptoethanol (2-ME) + 1 small Roche complete EDTA-free protease inhibitor tablet for 10 ml, or 1 large tablet for 50 ml added fresh before use - see note below) to each cell pellet. 

Note
Note: TN150 (50mM Tris.HCl pH7.8 / 150mM NaCl / 0.1% NP-40) should be made in advance as a stock solution in milliQ water and filter sterilised.

TN150plus (TN150  + 5 mM 2-Mercaptoethanol (2-ME) + 1X Roche complete EDTA-free protease inhibitor cocktail tablet of the appropriate size), to be made from TN150 shortly before use as 2-ME is unstable in water. 

NB. 2- ME is toxic and should be added in a fume hood.

20m

Add 2.5V of Zirconia beads (0.5mm, Thistle Scientific: ~ 2.5 ml, measure in 15 ml Falcon tube) to each tube and thaw the pellets rapidly by vortexing each tube for Duration00:01:00    (one vortex for each hand), then Duration00:01:00    TemperatureOn ice  . Repeat the bead-bashing another 5x. 

20m

Add another 3V TN150plus (~ 3 ml), shake vigorously, and centrifuge the suspension in the falcon tube for Duration00:20:00   at 4600g at Temperature4 °C  

20m

Transfer the supernatant (~ 4.5 ml) to 3x 1.5 ml eppendorf safe-lock tubes and spin lysate again for Duration00:20:00    at 20,000g in a microcentrifuge atTemperature4 °C  . 

25m

Protein A:IgG purification

Meanwhile, transfer 125 µl  of IgG Sepharose beads per sample (approx 75:25 beads:buffer so 167 µl of slurry) to a 15 ml falcon tube & wash 2x with 5 ml of TN150plus . (Resuspend by gently swirling beads. To pellet, pulse to 1000 rpm.) Divide beads between the same number of 15 ml falcon tubes as samples to be processed and remove the buffer. Resuspend in an equal volume of TN150plus. 


Note
Note: This bead selection method is for is for HTP tags. For HTF or HF tags, alternative selection methods using anti-FLAG beads are necessary, but not covered in this protocol.

25m

 Take a 5 µl aliquot from each crude extract from step 8 to be used for western blotting and store at Temperature-80 °C  .

10m

Mix the rest of each crude lysate  with the IgG Sepharose beads prepared at step 9 and nutate for Duration02:00:00    atTemperature4 °C   (can be left a bit longer).

Note
NB: Be careful to avoid taking the lipid that floats at the top – this will cling to the pipette tip, and can sometimes be seen as white wisps when you pipette up the lysate.

2h 20m

Spin down IgG Sepharose beads (pulse in centrifuge to 1000g at Temperature4 °C  ) and remove most of the supernatant. 

15m

Wash the  beads 2x with 10 ml TN1000plus (50mM Tris.HCl, pH7.8/ 1M NaCl/ 0.1% NP-40 with 5 mM  2-ME added fresh before use - see note below) then 2x with 10 ml TN150 ( + 2-ME but NO protease inhibitors!) (for each wash, gently agitate in the cold room for Duration00:05:00   ). Decant liquid between each wash.

Note
Note: TN1000 (50mM Tris.HCl pH7.8 / 1M NaCl / 0.1% NP-40) should be made in advance as a stock solution in milliQ water and filter sterilised.

TN1000plus (TN1000  + 5 mM 2-Mercaptoethanol (2-ME) + 1X Roche complete EDTA-free protease inhibitor cocktail tablet of the appropriate size), to be made from TN1000 shortly before use as 2-ME is unstable in water.

NB. 2- ME is toxic and should be added in a fume hood.  

NO Protease inhibitors should be added to the TN150 + 2-ME at this stage as they would inhibit the TEV protease required at step 16 below.

40m

After the last wash step, using a 1ml micropipette, resuspend the beads in a small volume of TN150 (+ 2-ME but NO protease inhibitors!), transfer to an eppendorf tube and remove the remaining buffer.

15m

TEV cleavage

2h 45m

 Add 600 µl of TN150 (+ 2-ME but NO protease inhibitors!) to the beads to resuspend them 

10m

 Add 7 µl of HALO-TEV protease (5u/µl, Promega) and mix by inverting tube.


Note
Note: The TEV cleavage step is required for HTP or HTF tags that incorporate a TEV protease cleavage step. For HF tags, this is replaced by a FLAG-peptide elution step.

 Incubate  Duration02:00:00    at Temperature18 °C   on a rotating wheel (make sure beads remain in suspension).

Spin down mixture (1000g) to capture all liquid stuck in the lid. Transfer everything to a  SnapCap column (Pierce) in an eppendorf tube and force the eluate through by opening and closing the cap. Spin the column in a second tube up to 1000g and pool the eluates to get ~ 600 µl of eluate). 
Note
KEEP THE ELUATE - BUT DO NOT PUT IT ON ICE (or it will not warm up sufficiently for the RNace-IT step below).

30m

RNAse treatment and Nickel purification

17h 5m

Meanwhile, for each sample, you should have an eppendorf tube prepared with 0.4 g of Guanidine-HCl in it.

10m

Partial RNase digestion with RNace-IT: Put 550 µl of the TEV eluate from  step 18 in a new tube (also take 25 µl aliquots for western blot samples (store at -80oC – labelled “TEV eluate”). Preincubate the remaining TEV eluates at Temperature37 °C   then add 1 µl of diluted RNace-IT and incubate the mixture for exactly Duration00:04:00   minutes at Temperature37 °C  , staggering the  samples by 30 seconds, so that each one gets precisely the same time of RNase treatment. When the time is up, immediately add 500 µl  to one of the tubes of 0.4 g Guanidine-HCl from step 19, cap and immediately invert. 


Note
Note: the amount of RNace-IT required to partially digest the RNA needs to be empirically determined for each RNA & protein: 1:10/1:20 give shorter fragments, 1:50/1:100 longer. For Ssd1 CRAC we used 1 µl of a 1:100 stock, diluted in water).

30m

 Vortex the samples well to dissolve the Guanidine HCl. Final volume should be around 700 µl.

Note
Note:  the Guanidine will increase the pH to ~8.2. Make sure that the pH of your Tris buffer stock is exactly 7.8.

Now put the samples back on ice and to each tube, add 27 µl 5 M NaCl (final conc 300 mM) and 3 µl 2.5 M Imidazole (pH 8.0) (final conc 10 mM).

10m

Mix the solution and add all to 50 µl of Nickel beads per reaction, aliquoted into eppendorf tubes  (from 100 µl of 1:1 beads:slurry; pre-equilibrated 2x in 10V Wash Buffer I  and spun up to 1000g before removing the buffer ).

Note
Note: Wash Buffer I (50mM Tris.HCl pH7.8 / 300mM NaCl / 0.1% NP-40/6M Guanidine HCl (28.66g/50ml)/10mM Imidazole/5mM 2-ME) should be made fresh shortly before use.

NB. 2- ME is toxic and should be added in a fume hood .  

10m

 NutateDurationOvernight   at Temperature4 °C  .

16h

Nickel purification (cont'd)

50m

 Transfer the beads/buffer mixture to a  SnapCap column in an eppendorf tube TemperatureOn ice  .

10m

Wash beads 3x in 400 µl cold Wash Buffer I plus by gravity flow.
Note
For the first wash with a new buffer, wash around the internal rim of the column.

Close and open the cap to get the flow started, and to hurry things along if the column is running slowly.

40m

If this is a test purification, for ONE SAMPLE go straight to Elution/PAGE (Step 42 - to check protein purification), for SECOND SAMPLE wash 3x with 1xPNK buffer + 2-ME then go to “Phosphorylating the 5’ ends of the RNA” (Step 36 -to check RNA crosslinking). If this is NOT a test purification, continue to Step 28.

TSAP Alkaline phosphatase treatment of precipitated RNAs

1h 45m

Wash beads 3x with 600 µl cold 1x PNK buffer + 2-ME - rinse inner wall of column with first wash.


Note
Note:  1x PNK buffer  (50mM Tris.HCl, pH7.8/ 10mM MgCl2/ 0.5% NP-40) can be made in advance.
For  1x PNK buffer + 2-ME , add 2-ME, which is unstable, to 5mM shortly before use.

NB. 2- ME is toxic and should be added in a fume hood.  

20m

Spin out the remaining buffer at Centrifigation1000 x g, 00:00:10 , put a plug (supplied with the columns) on the bottom of the SnapCap column to retain the reaction buffer, and place the column in a clean Eppendorf tube. Then, add 80 µl of the following mix (set up at room temp.): 16 µl 5x PNK Buffer  + 54µl MilliQ water  + 2µl RNasin + 8µl TSAP (Thermo-sensitive Alkaline Phosphatase) to each sample.


Note
For  5x PNK buffer (250mM Tris.HCl, pH7.8/50mM MgCl2/ 25mM 2-ME) - make up 10ml stock in advance and aliquot into 200 µl aliquots and store at Temperature-20 °C  .)

20m

Mix by stirring with pipette tip then flicking column gently. Close the lid.

 Incubate the beads for  Duration00:30:00   at Temperature37 °C  .

Note
ALWAYS open lid BEFORE removing plug, check occasionally for leakage from plug.

30m

On ice, wash the beads once with 400 µl Wash Buffer I (to make sure that the TSAP is inactivated; first wash should be round rim) and then three times with 400 µl 1x PNK buffer (to get rid of the guanidine). 

30m

On-bead ligation of miRCat-33 DNA linker (activated 5’, blocked 3’; aliquoted on arrival and thawed only once)

6h 5m

Spin out the remaining buffer and add 80 µl of a Master Mix composed of:  16 µl 5x PNK Buffer + 50µl MQ water  + 2µl RNasin + 8µl 3' linker (10µM) + 2µl T4 RNA Ligase I (NEB) + 2µl T4 RNA Ligase II K227A per sample .

Note
Note: prepare a MasterMix with enough for 1 more sample than you are working with to ensure you have enough.

The 3' linker DNA oligo has a blocked 3’ end and an activated adenosine at the 5’ end (5’-rAppTGGAATTCTCGGGTGCCAAGG/ddC/-3’). The blocked 3’ end prevents self-ligation. Activated adenosine is like the intermediate in T4 ligase reactions and helps efficiency of this step (3’ linker ligation is least efficient step). T4 ligase doesn’t “like” ligating RNA and DNA. This linker can be ligated to the RNA substrate in the absence of ATP (so any residual phosphorylated RNA isn’t self-ligated into a circle). After this step it is OK to have ATP there because transcripts with the 3’ linker attached will be blocked at the 3’ end). In this case, the RNAs should not ligate to themselves but only to the linker. Produces 5’OH-------ddddddd-/ddC/-3’

20m

Incubate the reaction for at least  Duration05:00:00     at Temperature25 °C  

Wash beads once with 400 µl wash buffer I  (freshly made; this ensures that the ligase is inactivated; first wash should be round rim) and then 3x with 400 µl 1x PNK buffer  (to get rid of guanidine) as before.

45m

Phosphorylating the 5’ ends of the RNA (radiolabelling)

2h 40m

Spin out the remaining buffer, plug columns and transfer to fresh 1.5ml tubes and add in the following order: 16µl 5x PNK Buffer + 56µl MilliQ water, then 4µl T4 PNK (Sigma, 5U/µl) and then 4µl 32P-γATP (10µCi/µl) per sample (make Master Mix without  32P-γATP added and then add the radiolabel).

30m

Incubate the reaction for Duration00:40:00   at Temperature37 °C   .

40m

Add 1 µl 100 mM ATP and let the reaction proceed for another 20 minutes.


Note
This step ensures that almost all of the 5’ ends have phosphates.

30m

At room temperature, wash beads 3x with 400 µl fresh wash buffer I  then 3-4x times with 1x PNK buffer  (until < ~20-50 cps in flow through, as measured with a GM monitor). 


Note
Here, we typically place a large number of open eppendorf tubes into a rack. We put the column into the first tube, let the wash flow through, then transfer the column to the next tube for the next wash. This avoids replacing the column into a tube that has contained radioactive washes, which can get messy.

On-bead ligation of the 5’ SOLEXA linker

16h 30m

Spin out the remaining buffer from Step 39 and add 80 µl of the following mix:  16µl 5x PNK Buffer + 55.2µl MilliQ water + 0.8µl 100mM ATP + 2µl 100µM 5'-linker (a unique linker for each sample) + 2µl RNasin + 4µl T4 RNA ligase.

Note
The 5’ linkers came from IDT.  They are mixed DNA:RNA oligos with inverted ddT at the 5’ end to prevent degradation; at the 3’ end is a barcode sequence, a random 3-mer to reveal pcr duplicates, and a constant 3 nucleotide 3’ terminus to ensure all linkers ligate with equal efficiency. Again, these are aliquotted into 5 µl aliquots, which are only thawed once or twice.

30m

Incubate at  Temperature16 °C   DurationOvernight   .

16h

Elution and PAGE (Day 1)

8h 30m

Wash the beads 3x with 400 µl of  Wash Buffer II.

Note
Wash Buffer II (50mM Tris.HCl,pH7.8/ 50mM NaCl/ 0.1% NP-40/ 5mM 2-ME - made fresh)  

Wash Buffer II plus (To 5ml Wash Buffer II, add 280µl of 140mM Imidazole stock just before use).

30m

Spin out the void volume and elute RNP complexes twice with wash buffer II plus. For each elution, put plug on column, incubate beads with 62.5 µl of elution buffer (for -/+ heatshock samples) or 125µl (for single control samples) for10 minutes, spin into RNase-free eppendorf, repeat); pool eluates. 

30m

Add 40µg (2µL) of Glycoblue to each sample and 5V of acetone (1.25 mL) and leave  at -20ºC for at least Duration02:00:00    before spinning at Centrifigation16000 x g, 4°C, 00:05:00   , removing the liquid, spinning again briefly to remove residual acetone and resuspending the pellets in 25µl of 1x  NuPAGE Sample Buffer (with 2-ME added to 6%).  Heat samples at Temperature65 °C  for Duration00:10:00   mins and then spin briefly. Pipette up and down to check fully resuspended using the Geiger counter. (At the same time, the  crude lysate and TEV eluate samples collected earlier can be mixed with 4x NuPAGE Sample Buffer + 24% 2-ME, heated at Temperature95 °C   for Duration00:05:00   , ready to run on a second NuPAGE gel for Western Blot analysis.

Load radioactive samples in alternate wells of a 1.5 mm thick 10 well NuPage 4-12% gradient gel in 1x NuPAGE MOPS running buffer (500 ml). Ensure samples and ladder (SeeBlue Plus 2 or similar) are well separated, and use a standard 1.0mm thick12-well NuPAGE 4-12% gradient gel with Abcam protein markers (or similar) for the Western Analysis. Run gels at 150V for Duration01:00:00   - Duration01:30:00   until the blue dye reaches the bottom. 

Note
NB. this gel system is absolutely essential since the pH remains roughly Ph7  during the run. You cannot use the “normal” SDS-PAGE gels because the pH can go up to Ph9  leading to hydrolysis of your RNA.

1h 45m

Transfer the proteins to Hybond-C Extra nitrocellulose membrane (Amersham; or Similar) using the wet transfer system and NuPAGE Transfer Buffer (Life Technologies : 1 litre; 15 % MeOH (although the methanol can be omitted for large proteins). Transfer the proteins for Duration01:30:00   at 100V. 

Note
Blot setup: 

Hold membrane and 1 Whatman filter paper together and dunk in Transfer Buffer (TB). Smooth out bubbles. Place on top of gel and peel gel off onto membrane. Add 1 Whatman filter soaked in TB to top. Soak sponges, and assemble the final sandwich. Ensure gel to negative (black), membrane to positive. (Cut membrane and three whatmans to 8 x 6.5cm. Crack open with wedge and place membrane on top. Dip into the buffer. Place one Whatman filter on top of membrane. Flip over so that you can see the gel and dip in buffer. Pry apart with wedge. Place on white side of cassette (on top of the sponge). Place whatman on top and close. Place in apparatus. (Black to black and white to red.).

1h 45m

For Western analysis block Duration01:00:00   in 5% skimmed milk in TBS-Tween (TBS-T), and probe DurationOvernight   at 4°C with a 1:5000 dilution of rabbit anti-TAP antibody (Open Biosystems) in the blocking buffer. 


Note
Note: Different antibodies will be needed to detect HF-tagged proteins.

For the radiolabelled blot (test crosslinking or full CRAC expt): briefly dry membrane, expose to film (place membrane in acetate sleeve with luminous ladder for orientation well away from the membrane then put into film cassette so that the film is next to the intensifying screen (white) then the membrane is on top of the film. Duration01:00:00   at -80ºC with  an intensifying screen is normally enough but sometimes DurationOvernight  is required (as was the case for Ssd1-HTP CRAC). Kodak MS film is most sensitive film, MP is less sensitive but sometimes adequate.

15m

Elution and PAGE (Day 2)

6h 20m

Wash the western blot 3x in TBS-T for Duration00:10:00   each then probe Duration01:00:00  at RT with 1:10,000 IRDye680 conjugated Donkey anti-rabbit secondary antibody in TBS-T. Wash 3x Duration00:05:00   each  in excess TBS-T then coolect image on the Licor Odyssey.
 

1h 45m

Develop film of radio-active blot and then take a photo or scan the film as it will be cut at the next step.

30m

Cut out the position of the bands corresponding to the size of your protein + the RNA from the autorad: cut from the middle of the tight band plus the smear above (to try and get mostly cross-linked species). Use the position of the luminous ladder to orientate the film over the membrane and cut out the region of the membrane within the cut-out region of the film, using a separate scalpel for each sample to prevent cross-contamination. Slice each piece of membrane into a few bits. (Can store membrane slices DurationOvernight   atTemperature-80 °C   ).

20m

 Incubate the membrane slices with 400 µl of wash buffer II containing 1% SDS and 5 mM EDTA and add 100 µg (5 µl) of Proteinase K (Roche;  20 mg/ml stock in water, stored at -20ºC). Shake at Shaker500 rpm, 55°C, 02:00:00  .

Transfer the supernatant to a fresh tube (to remove the membrane), and add 50 µl of 3M NaOAc, pH 5.2 (pH’d with acetic acid) and 500 µl of Phenol:Chloroform:Isoamyl Alcohol (25:24:1). Vortex, Centrifigation12000 x g, Room temperature  for Duration00:20:00    then take the top layer to a new tube.

30m

Precipitate the RNA with 1 ml of absolute Ethanol and 2µl of Glyco-blue. Incubate atTemperature-80 °C  for Duration00:30:00   then spin at Centrifigation16000 x g, 4°C, 00:20:00  ) (or store at Temperature-20 °C   DurationOvernight  ).

Wash pellet with 70% EtOH (vortex), spin for Centrifigation16000 x g, 4°C, 00:05:00  , remove liquid and air-dry.

15m

Reverse Transcription

2h 10m

Resuspend the RNA pellet in 13µl of the following mix (by pipetting): 11µl  of MQ water + 1µl  of 10µM miRCat RT oligo (CCTTGGCACCCGAGAATT) + 1µl of freshly mixed 10mM dNTPs and heat at Temperature80 °C   forDuration00:03:00   before snap-chilling on TemperatureOn ice   for Duration00:05:00  . Collect the contents by brief centrifugation and add 6 µl of the following mix: 4µl  of 5x First Strand Buffer (from Superscript IV kit)  + 1µl  of 100mM DTT (from kit) + 1µl  RNasin (40u/µl ) prepared as a 7x Mastermix. 

Incubate the mixture at Temperature50 °C   for Duration00:03:00   mins and then add 1 µl of Superscipt IV (kit) and incubate the reaction for Duration01:00:00   at Temperature50 °C  .

1h 3m

 Inactivate Superscipt IV by incubation at Temperature65 °C  for Duration00:15:00  .

15m

 Add 2 µl of RNase H (NEB) and incubate for Duration00:30:00   atTemperature37 °C  .

35m

PCR Amplification

3h 20m

Use 3x 4 µl of each RT reaction for PCR. For each RT reaction,  make 3x 50µl reactions containing 5µl 10x LA Taq Buffer + 1µl each of 10µM PCRfwd (P5 PCR Forward Primer)and PCRrev (PE mircat Reverse Primer) primers + 1µl of 10mM dNTPS (fresh!) + 39.25µl of nuclease-free water + 0.5µl Takara LA Taq Polymerase + 4µl of RT reaction from previous step. (NB: the oligo sequences depend on your 5’ linker).


Note
P5 PCR Forward Primer: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

PE mircat Reverse Primer:
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGGCCTTGGCACCCGAGAATTCC

50m

PCR amplify using the following Programme: (95ºC for 2 min; (98ºC for 20s/52ºC for 20s/ 68ºC for 20s) for 20-25 cycles( use the minimum number of cycles possible - try 23-24 for a first attempt, then reduce the number of cycles if possible to give a total yield of ~5-50 ng of DNA - used 22 cycles for Ssd1-HTP CRAC ); 72ºC for 5 mins).

Pool and precipitate products: add, on ice, 2.5V EtOH (375 µl) + 0.1V 3.0 M NaOAc (15 µl) + 20 µg Glycoblue (1 µl of 20 µg/µl); incubate atTemperature-80 °C   for Duration00:30:00   then spin atCentrifigation16000 x g, 4°C, 00:20:00  , wash pellets in 70% EtOH, spin againCentrifigation16000 x g, 4°C, 00:20:00 , air dry (make sure all ethanol is evaporated, or your sample will float out of the wells when you run it on the gel)  and resuspend in 15 µl nuclease-free water.

1h 30m

Gel Purification

5h 25m

Prepare a 3% Metaphore agarose gel (75 ml in 1x TBE Buffer) while PCR is running, (takes a while): soak agarose in 1xTBE for 30 min; heat slowly in microwave (will make lots of foam); add 1:10,000 dilution of SYBR Safe ;  pour carefully (use a pipette to eliminate bubbles) and remove bubbles (rake with comb); when gel is set, put it at 4°C until samples are ready (at least 30 min).

Add 6x Purple Loading Dye (New England Biolabs) to samples (use 5 µl of loading dye for a 15 µl sample, to help ensure that the sample does not float out of the wells even if there is a little bit of residual ethanol). Run the gel with the kit mounted on a metal block in ice to prevent it melting!

10m

Load samples (rinse tip in beaker of 1xTBE after taking up sample, to ensure no sample is on the outside of the  tip) and  include 6 µl of a 50 bp DNA ladder (NEB).

15m

Run gel at 80V until  bromphenol blue band to the bottom. Scan gel using the phosphorimager, and print at 100% magnification as a negative image.

2h 30m

To visualize bands, place the printed 100% sized gel image under a sheet of acetate. Cut bands from agarose gel using a scalpel. You should see a sharp band at ~120 bp from linker dimers… you do not want to cut this. Your library should migrate as a smear starting at ~130 bp and extending for 50 bp or more. Used scalpels (1 per lane) to cut out area of gel above primer dimers up to ~180bp. Re-scan gel after cutting out to ensure the correct region has been excised OK.

30m

Gel Extraction

Using the QIAquick Gel Purification KIt (Qiagen) or Zymo Gel Clean and Concentrate Kit with mini elute columns, follow the provided gel extraction protocol by melting the gel at Temperature42 °C  , washing in Buffer QG (without isopropanol) and letting the column stand in an additional PE Buffer wash step for Duration00:10:00  (inverting the column: ensures all GHCl is removed). Elute with 20µl nuclease-free water: put water on membrane and let stand for 2-3 mins before spinning out. This is your sample for high throughput sequencing. We measure the DNA concentration using the QuBit with the dsDNA HS Assay Kit.
 

Checking CRAC Library Concentrations

15m

The concentration of the CRAC Library generated above is checked on the Qubit Fluorometer (ThermoFisher Scientific), using the Qubit dsDNA HS Assay Kit (ThermoFisher Scientific) and manufacturer's protocol.

Bring all solutions to room temperature.

15m

Prepare Standards and Samples to be Tested:

Set up required number of Qubit 0.5ml assay tubes for standards (x2) and the number of samples to be assayed and label the lids.

Prepare sufficient Qubit® Working Solution (to accommodate all standards and samples, allowing 200µl for each) by diluting the Qubit® dsDNA HS Reagent 1:200 in Qubit® dsDNA HS Buffer. 

Add 190 µL of Qubit® working solution to each of the  standard tubes and 198 µL to each sample tube.

Add 10 µL of each Qubit® standard or 2 µl  of test sample to the appropriate tube, then mix by vortexing for 2–3 mins. (Be careful not to create bubbles!).

Incubate at room temp. for 2 mins.

30m

Calibration of Fluorimeter:

Plug in Qubit 2.0 Fluorimeter and switch on. On the Home screen, press 'DNA', then select 'dsDNA High Sensitivity' as the assay type. The 'Read standards' screen is displayed. If option to use previous calibration is offered, ignore it and set new standards. Press 'Read Standards' to proceed.

Insert Standard #1 tube into  the sample chamber, close the lid, then press 'Read standard'. When the reading is complete (~3s), remove Standard #1. Repeat with Standard #2. Instrument will draw a Standard Curve.

10m

Measuring Sample Concentrations:

Press 'Run Samples'. 

Add first sample tube and measure - this gives the QFvalue of the diluted sample in ng/ml. By diluting the sample 2 µL to 200µL for measurement this is the concentration of a 1/100 dilution.

Calculate stock concentration by multiplying by 100. 

Conc. of library =  QFvalue x 200/2 ng/ml

Convert to ng/µL = conc. in ng/ml/1000

Repeat for each sample.

40m

Prepare 10nM dilutions of each library:

Average concentration of 150nt DNA fragments @ 1ng/µL = 10nM

Make 10nM dilutions of each library by diluting to 1ng/µL

(ie. if library conc. = y ng/µL, dilute 2µL of library to a total volume of (2 x y)µL.

If concentration of the untagged negative control sample is below 1ng/µL, dilute by the same amount as for the lowest library concentration.

30m

Preparing CRAC Libraries for Sequencing

Prepare for MiniSeq Run:


Note
Note: this library could now be submitted to (any) Illumina sequencer. The Miniseq is only one option.

Remove Reagent Cartridge from -20°C Freezer and thaw gently in a tray of warm tap water for at least Duration00:30:00  .

Thaw Hybridisation Buffer from -20°C atTemperatureRoom temperature   and then store TemperatureOn ice  , vortex briefly before use.

Bring Flow Cell to TemperatureRoom temperature   for at least Duration00:30:00   in its foil wrapper.

Make a fresh dilution of 0.1N NaOH from stock and mix well.

Make a 200mM dilution of Tris.HCl, pH7.0 and mix well.

Prepare RSB Buffer: 10mM Tris.HCl, pH8.5 + 0.1% Tween-20.

Dilute and Denature Libraries:

Prepare 10µL of 1nM pooled libraries by mixing 1µL of each 10nM library and making it up to 10µL with RSB Buffer, vortex briefly and spin at Centrifigation1000 rpm, Room temperature, 00:01:00  .

Denature 5µL of this pool by adding 5µL of 0.1N NaOH and incubate at TemperatureRoom temperature   for Duration00:05:00  .

Add 5µL of 200mM Tris.Hcl, pH7.0, vortex briefly and spin  Centrifigation280 x g, 00:01:00 .

Add 985µL of pre-chilled Hybridisation Buffer from Kit to denatured library (Total vol. = 1ml of 5pM). Vortex briefly and spin at Centrifigation280 x g, 00:01:00  .

Transfer 135µL diluted library to a new microcentrifuge tube and add 365µL of  pre-chilled Hybridisation Buffer. Total vol. is 500µL at 1.8pM. 

Vortex briefly and spin atCentrifigation280 x g, 00:01:00  .

30m

Set up MiniSeq System:

Switch Instrument ON and after automated check, select START.

From Home Screen, select **Sequence**. This releases consumables from previous run and opens a series of run setup screens.

Open reagent door by gently pulling forward  on the side edges and remove formamide waste bottle and transfer waste to bottle in fumehood, replace waste bottle.

Prepare flow cell: remove from foil with clean gloves, unscrew container and carefully remove flow cell from holder by the plastic cartridge. Clean glass surface of flow cell, avoiding the black flow cell gasket, with an alcohol-soaked lens tissue and dry with a dry lens tissue. Hold up to light and check for any smears. Dry flow cell with spray air and recheck. Load into Flow Cell Compartment after removing old one by pressing the release button. Close latch and compartment door.

Dry thawed Reagent Cartridge with paper towel, invert 5x to ensure reagents within are mixed and then check for no bubbles or ice crystals. Tap gently on bench to disperse any bubbles

Load denatured library into well 16 of Reagent Cartridge by piercing the foil with a clean pipette tip and then loading with a micropipette. Check for bubbles at bottom.

Remove old spent cartridge if present. Slide cartridge loaded with library into slot on sequencer until cartridge stops.

30m

Enter Run Parameters:

1. Enter a run name of your preference.
2. [Optional] Enter a library ID of your preference.
3. From the Recipe drop-down list, select a recipe. Only compatible recipes are listed (For CRAC use 'TruSeqSmallRNA', sequence length = '75')
4. Select a read type, either Single read or Paired end (we do Single End Reads so select "Single").
5. Enter the number of cycles for each read in the sequencing run.


**NOTE: Do not open the reagent compartment door or the flow cell compartment door during the automated
check or during the sequencing run.**

15m

Collect Sequencing Data from the machine and Analyse. The structure of a sequencing read prepared from the library is shown below. We use Sander Granneman's CRAC pipelines (available from https://git.ecdf.ed.ac.uk/sgrannem/crac_pipelines), built on the pyCRAC software, to analyse the data. However, the choice of analysis steps depends on your protein's binding patterns and on your scientific goals.

Public workspaceCRAC Analysis in Budding Yeast with HTP Tagged Proteins

CRAC Analysis in Budding Yeast with HTP Tagged Proteins