Jul 30, 2020

Public workspaceCoVan RT-LAMP protocol V.3

This protocol is a draft, published without a DOI.
  • David O'Connor1,
  • Shelby O'Connor1,
  • Amelia Haj1,
  • Mitchell Ramuta1,
  • Christina Newman1,
  • Dawn Dudley1
  • 1University of Wisconsin-Madison
Amelia Haj
Icon indicating open access to content
QR code linking to this content
Protocol Citation: David O'Connor, Shelby O'Connor, Amelia Haj, Mitchell Ramuta, Christina Newman, Dawn Dudley 2020. CoVan RT-LAMP protocol. protocols.io https://protocols.io/view/covan-rt-lamp-protocol-bi7nkhmeVersion created by Amelia Haj
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 30, 2020
Last Modified: July 30, 2020
Protocol Integer ID: 39886
Materials
MATERIALS
Reagent1X PBS (Phosphate-buffered saline )
Reagent1.5 mL Eppendorf tubes
ReagentWarmStart Colorimetric LAMP 2X Master Mix (DNA and RNA) - 100 rxnsNew England BiolabsCatalog #M1800S
ReagentPCR tubes
ReagentMicrocentrifuge
ReagentDigital Heating Shaking Bath, Block 96 wellThermo FisherCatalog #88880125
Reagent1.5 mL reaction tubesSarstedtCatalog #72.690.001
ReagentP1000 pipette tips
Reagent10X stock of RT-LAMP primers (Color Genomics N-gene)*
Reagent1e6 copies/ml UV-inactivated SARS-CoV-2 positive control
ReagentCooler with freeze-packs


PrimerAbbrev.Primer sequence10x concentration
Forward Outer Primer (F3)Color-N-F3AACACAAGCTTTCGGCAG2 µM
Backward Outer Primer (B3)Color-N-B3GAAATTTGGATCTTTGTCATCC2 µM
Forward Internal Primer (FIP)Color-N-FIPTGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC16 µM
Backward Internal Primer (BIP)Color-N-BIPCGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG16 µM
Forward Loop Primer (LF)Color-N-LFTTCCTTGTCTGATTAGTTC8 µM
Backward Loop Primer (LB)Color-N-LBACCTTCGGGAACGTGGTT8 µM
* 10X RT-LAMP Primer Stock

Safety warnings
Because this protocol uses potentially infectious human samples, be sure to wipe down tubes and workstations frequently with 10% bleach to ensure safe handling of samples and a safe work environment. Instances where this is recommended are noted in the protocol.
Saliva collection area
Saliva collection area
2m
2m
Prepare saliva collection tube by placing a p1000 pipet tip in a 1.5 ml tube
Obtain ~300 µl of saliva – have the individual spit into a tube using a P1000 pipet tip to funnel saliva into the tube


Safety information
Infection control: Have individual throw the p1000 pipet tip away in a biohazard bag, close the cap of the 1.5ml tube, and wipe down the outside of the tube with 10% bleach



Place the saliva sample in a cooler with ice packs and transport the saliva to the sample preparation table
Sample preparation area
Sample preparation area

Safety information
Infection control: Wipe down the outside of the tube again with 10% bleach.


Heat saliva sample at 65ºC for 30 minutes, while shaking gently at 300 rpm, to inactivate virus

Note
This is a good time to start preparing the RT-LAMP master mix (step 9)

Heat and shake sample at 98ºC for 3 minutes to liberate RNA and help inactivate some of the enzymes in saliva
Spin down tubes in microcentrifuge for 2 minutes to pellet cell debris in the saliva

Safety information
Infection control: Wipe down the microcentrifuge with 10% bleach and 70% ethanol after spin; wipe down tubes with 10% bleach

Add 50 µl of saliva to a 1.5 ml Sarstedt tube with 50 µl of 1x PBS to buffer against variability in pH and make the sample easier to handle
Safety information
Infection control: Wipe down the tubes with 10% bleach

Transport the saliva + PBS tubes to the RT-LAMP testing area

Safety information
Infection control: Wipe down the tubes with 10% bleach


RT-LAMP area
RT-LAMP area
Prepare RT-LAMP master mix:



ReagentMaster mix (1 reaction)Your reaction volumes:
WarmStart 2X MM10 µl
LAMP primer mix (10X)2 µl
dH2O5 µl
Sample3 µl
Total Volume20 µl



Aliquot 17 µl of RT-LAMP master mix into a new set of PCR strip tubes – two for each sample, plus two each for positive and negative controls
Add 3 µl of saliva/PBS mix to 17 µl RT-LAMP master mix in duplicate – two tests per individual


Safety information
Infection control: Wipe down the tubes with 10% bleach

For a positive control, add 3 µl of a 1e6 copies/ml UV-inactivated SARS-CoV-2 stock to two 17 µl RT-LAMP master mix tubes. (More information on how to prepare a positive control stock here.) For a negative control, add 3 µl of water to two 17 µl RT-LAMP master mix tubes.
Heat and shake sample + master mix at 65ºC for 30 minutes
Observe RT-LAMP reaction result for each individual. All four controls (two positive and two negative) must be correct in order to consider results valid. If any of the controls don't work, repeat the entire run.

Both sample tubes are PINK: negative result
Both sample tubes are YELLOW: positive result

One sample tube is PINK and one sample tube is YELLOW: positive, but retest –
  • Re-run sample 4x using the same PBS/saliva mix
  • Optional PCR confirmation of results