License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 11, 2026
Last Modified: June 24, 2026
Protocol Integer ID: 316802
Keywords: ASAPCRN, blue fluorescent protein, atp11c, matched set of fluorescent fusion, fluorescent fusion, using gibson assembly, comparative analysis of tmem230, gibson assembly, colony pcr, tmem230, sequencing
Funders Acknowledgements:
ASAP
Grant ID: ASAP-024297
Abstract
This protocol describes the generation of a series of fluorescently tagged constructs used to investigate TMEM230, VAMP3, and ATP11C interaction. Blue fluorescent protein (BFP) was first amplified with sequence‑specific overhangs and used to replace mCherry in TMEM230‑mCherry plasmids through PCR‑based removal of the mCherry cassette followed by Gibson assembly. Resulting TMEM230‑BFP constructs were screened by colony PCR, restriction digest, and confirmed by plasmid sequencing. To generate VAMP3‑BFP, the VAMP3 coding region was PCR‑amplified from a GFP‑VAMP3 template and assembled into a BamHI/KasI‑linearized C‑BFP backbone using Gibson assembly. Positive clones were validated by diagnostic digestion and sequencing. Finally, ATP11C wild‑type and ATP11C(E184Q) coding sequences were obtained from previously published constructs and fused to C‑terminal mCherry tags before subcloning into pcDNA3.1. Together, these cloning strategies produced a matched set of fluorescent fusion constructs enabling comparative analysis of TMEM230, VAMP3, and ATP11C localization and function in mammalian cells.
Required DNA templates
A de novo-synthesised codon-optimised DNA sequence encoding the short isoform of human TMEM230 (UniProt: Q96A57‑1) was cloned into the pcDNA3.1 backbone by Azenta to generate:
An N-terminal mCherry fusion (N-mCherry-TMEM230) - addgene plasmid # 255856
A C-terminal mCherry fusion (C-TMEM230-mCherry) - addgenne plasmid # 255857
A DNA sequence encoding human ATP11C and ATP11C(E184Q) was a gift from Hye-Won Shin, Addgene plasmid # 209220 and Addgene plasmid # 209251, respectively.
A DNA sequence encoding human VAMP3 was a gift from Thierry Galli, Addgene plasmid # 42310.
A DNA sequencing ORF of monomeric BFP (mTagBFP) was a gift from Orsoyla Mozner
Cloning conditions
All PCR amplifications were performed using Q5® High‑Fidelity DNA Polymerase according to the manufacturer’s instructions unless stated otherwise.
All Gibson reactions were performed using GeneArt™ Gibson Assembly HiFi Cloning Kit, according to the manufacturer’s protocol, unless stated otherwise.
All PCR products were purified using the GeneJET PCR purification kit, according to the manufacturer’s protocol, unless stated otherwise.
Plasmids and primers used in this study are listed in Supporting Tables 2 of the manuscript and below.
Name
Target
Sequence
Oligo1
BFP ORF
5’-GAATTCAGCGAGCTGATTAAG-3’
Oligo2
BFP ORF
5’-GCCATTAAGTTTGTGCCC-3’
Oligo3
BFP ORF
5’-GAATTCAGCGAGCTGATTAAG-3’
Oligo4
BFP ORF
5’- GAATTCATTAAGTTTGTGCCC-3’
Oligo5
N-mCherry-TMEM230
5’-GCACAAACTTAATGGCGGCGGAAGCAG-3’
Oligo6
N-mCherry-TMEM230
5’-CTTAATCAGCTCGCTGAATTCGCCGCTGCTG-3’
Oligo7
C-mCherry-TMEM230
5’-GCACAAACTTAATGAATTCGGCAGCGGTAG-3’
Oligo8
C-mCherry-TMEM230
5’-CTTAATCAGCTCGCTGAATTCGCCGGAGCTG-3’
Oligo9
pEGFP plasmid
5’- CCAAGCTGGCTAGCGGATCCATGTCTACAGGTCC -3’
Oligo10
pEGFP plasmid
5’-ATAGCACCTCCAGGGCGCCTGAAGAGACAACCC --3’
Primers used in the protocol.
Step 1. Amplification of BFP with overhangs (PCR)
The mTagBFP open reading frame was used to generate overhangs for Gibson assembly.
For the N-terminal construct, the BFP was amplified with Oligo1 & Oligo2, while for the C-terminal version, with Oilgo3 & Oligo4, with annealing temperature of 52 °C and elongation time of 60 seconds.
The PCR product was purified using the GeneJET PCR purification kit
Step 2. Removing mCherry from TMEM230-mCherry constructs (PCR)
The N-mCherry-TMEM230 and C-terminal mCherry plasmids were used as templates.
The mCherry coding sequence was removed by inverse PCR from N‑mCherry‑TMEM230 using Oligo5 & Oligo6, and from C‑TMEM230‑mCherry using Oligo7 & Oligo8 with an annealing temperature of 66 °C and elongation time of 240 seconds.
Treat samples with 0.5 ul Fast digest DpnI/50 ul PCR reaction for 1 hour at 37 degrees.
The PCR product was purified using the GeneJET PCR purification kit.
Step 3. Generation of TMEM230-BFP constructs (Gibson assembly)
Linearised plasmids from Step 2. were combined with a BFP insert from Step 1. with an appropriate overhang in a 1:2 molar ratio of vector:insert.
The Gibson assembly reaction was performed according to the manufacturer's protocol.
50 ul of chemically competent DH5α cells were transformed and plated on LB-Ampicillin plates.
Selected colonies were grown in suspension cultures, and DNA was isolated with a miniprep kit.
Positive constructs were confirmed by test digestion with BamHI and SalI, followed by whole plasmid sequencing.
Step 4. Generation of VAMP3-BFP construct (Gibson assembly)
The GFP‑VAMP3 plasmid (gift from Thierry Galli; Addgene #42310) was used as a template for PCR.
The VAMP3 coding sequence with appropriate overhangs was amplified using Oligo9 & Oligo10 with an annealing temperature of 54 °C and an elongation time of 60 seconds.
The C‑BFP‑TMEM230 plasmid was digested with BamHI and KasI to remove the TMEM230 insert and generate a linearised C‑BFP backbone.
The sample was analysed by agarose gel, and the linearised C-BFP backbone was cut out of the gel and purified using the GenJet Gel extraction kit according to the manufacturer's protocol.
The linearised vector was combined with the amplified VAMP3 fragment in 1:2 molar ratio of vector:insert.
The Gibson assembly reaction was performed according to the manufacturer's protocol.
50 ul of chemically competent DH5α cells were transformed and plated on LB-Ampicillin plates.
Selected colonies were grown in suspension cultures, and DNA was isolated with a miniprep kit.
Positive constructs were confirmed by test digestion with BamHI and EcoRI and 2.5% agarose gel, followed by whole plasmid sequencing.
Step 5. ATP11C constructs
DNA encoding ATP11C (WT) and ATP11C E184Q was obtained from (Both plasmids were a gift from Hye‑Won Shin):
pCAG/ATP11C‑HA (Addgene #209220)
pCAG/ATP11C(E184Q)‑HA (Addgene #209251)
ATP11C fragments were fused to C‑terminal mCherry tags and cloned into the pcDNA3.1 vector by Azenta.