Aug 10, 2023
Complete Hepatitis B Virus Sequencing using an ONT-Based Next-Generation Sequencing Protocol
- Wonderful CHOGA1,
- yeshnee.m 1,
- Lucious Chabuka1,
- Tongai Maponga1,
- Derek Tshiabuila2,
- James Emmanuel San2,
- Houriiyah Tegally2,
- Monika Moir2,
- Sureshnee Pillay1,
- Richard Lessells2,
- Cheryl Baxter2,
- Jennifer Giandhari1,
- Eduan Wilkinson1,
- Tulio De Oliveira2
- 1Centre for Epidemic Response and Innovation, Stellenbosch University;
- 2University of KwaZulu-Natal
Protocol Citation: Wonderful CHOGA, yeshnee.m , Lucious Chabuka, Tongai Maponga, Derek Tshiabuila, James Emmanuel San, Houriiyah Tegally, Monika Moir, Sureshnee Pillay, Richard Lessells, Cheryl Baxter, Jennifer Giandhari, Eduan Wilkinson, Tulio De Oliveira 2023. Complete Hepatitis B Virus Sequencing using an ONT-Based Next-Generation Sequencing Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvo3xxzv4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: June 06, 2023
Last Modified: August 10, 2023
Protocol Integer ID: 82964
Keywords: HBV, full genome, ONT, pan-genotypic primers, tilling primers, PCR, entire hbv genome, generation sequencing protocol, generation sequencing protocol this protocol, pcr tiling of sar, using hbv, pcr tiling, primer sequence, primers from dna extract, detailed instructions for pcr amplification, nanopore rapid kit, specific tiling primer, nanopore rapid kit for minion, hbv, pcr, pcr amplification, ont protocol for sar, rapid barcoding kit, using oxford nanopore technology
Funders Acknowledgements:
Abbott Laboratories
Grant ID: 13270200
Abstract
This protocol outlines the process of generating complete Hepatitis B virus (HBV) primers from DNA extracts for next-generation sequencing using Oxford Nanopore Technology (ONT). Specifically, we have designed pan-genotypic tiling primers to cover the entire HBV genome for sequencing. The hands-on time required for a batch of 48 samples is minimal, approximately 1 hour and 30 minutes. This protocol is straightforward and can be easily adapted in settings where the ONT protocol for SARS-CoV-2 has been implemented. We provide detailed instructions for PCR amplification using HBV-specific tiling primers, sample pooling, library construction using the Rapid Barcoding Kit (SQK-RBK110.96), quantification using Qubit, and subsequent sequencing on the GridION platform.
The Rapid barcoding protocol for up-to 96 samples "PCR tiling of SARS-CoV-2 virus with rapid barcoding (SQK-RBK110.96)" https://community.nanoporetech.com/protocols/pcr-tiling-of-sars-cov-2-virus-with-rapid-barcoding-sqk-rbk110/v/PCTR_9125_v110_revA_24Mar2021.
This protocol describes a modified version of the 1200bp amplicon "midnight" primer set for nCoV-2019 (SARS-CoV-2) amplification, utilizing the Nanopore Rapid kit for MinION. The modification was developed by Nikki Freed. https://dx.doi.org/10.17504/protocols.io.bwyppfvn and the original publication is found here : https://doi.org/10.1093/biomethods/bpaa014.
Primers were all designed using Primal Scheme: http://primal.zibraproject.org/, described here https://www.nature.com/articles/nprot.2017.066.
Primer sequences are here (and listed directly in the protocol) :
Materials
QubitTM Assay TubesInvitrogen - Thermo Fisher Catalog #Q32856
Qubit dsDNA HS Assay kitThermo Fisher Scientific Catalog #Q32854
Q5 Hot Start High-Fidelity DNA Polymerase - 100 unitsNew England Biolabs Catalog #M0493S
DNA 1K / 12K / Hi Sensitivity Assay LabChipPerkin Elmer Catalog #760517
General PCR laboratory equipment and consumables Contributed by users (GridION, Qubit (Fluorometer), LabChip Fragment Analyzer)
Primers-specific for HBV according to Primal Scheme (Pool 1 -even numbers)
Artic Primers-specific for 2019-nCoV according to Primal Scheme (Pool 2 -odd numbers)
Rapid Barcoding Kit (RBK109)
Nuclease Free Water
Troubleshooting
Quantification of DNA using Qubit
Prepare the two standards calibrate the Qubit Fluorometer using Qubit dsDNA HS Assay kit Thermo Fisher Scientific (Qubit® dsDNA HS Reagent).
Label the tube lids. Do not label the side of the tube as this could interfere with the sample reading. Use only thin-wall, clear, 0.5mL PCR tubes. Acceptable tubes include Qubit™ assay tubes (Cat. No. Q32856)
For standards [STD]: Aliquot 190 µL of Qubit® dsDNA HS Reagent working solution to each 500 µL thin-walled polypropylene tubes .
For sample tubes: Aliquot 199 µL of Qubit® dsDNA HS Reagent working solution.
Note
The final volume in each tube must be 200 µL once sample/standard has been added.
Add 10 µL of STD 1 to the aliquoted 190 µL .
Mix each tube vigorously by vortexing for 3–5 seconds without creating bubbles.
Incubate at room temperature for00:02:00 prior to measuring the concentation using Qubit Fluorometer. **
Note
** Do not delay (exceed) 00:02:00 ; the Qubit reagents are light sensitive.
2m
After calibrating the machine with STD 1 & 2 proceed to measuring DNA for samples.
First, aliquot 199 µL of Qubit® dsDNA HS Reagent into a 500 µL thin-walled polypropylene tubes.
Add1 µL of the specific sample to each well containing the pre-allocated 190 µL of sample.
Mix each tube vigorously by vortexing for 3–5 seconds without creating bubbles.
Incubate at room temperature for 00:02:00 . Measure the concentation using Qubit Fluorometer.
Note
- If you are adding 1–2µL of sample, use a P-2 pipette for best results.
- Remember, do not delay (exceed) 00:02:00 ; the Qubit reagents are light sensitive.**
2m
After calibrating the machine proceed to measuring DNA for samples.
First, aliquot 199 µL of Qubit® dsDNA HS Reagent into a 500 µL thin-walled polypropylene tubes.
Add1 µL of the specific sample to each well containing the pre-allocated 190 µL of sample.
Pulse vortex for 00:02:00 seconds to mix thoroughly without producing bubbles.
Incubate at room temperature for 00:02:00 . Measure the concentation using Qubit Fluorometer.
Allow all tubes to incubate at room temperature for 2 minutes, then proceed to “Read standards and samples”.
** Do not delay (exceed) 00:02:00 ; the Qubit® dsDNA HS Reagent are light sensitive.**
6m
Primer design (Pan-genotypic/ universal tiling primers)
1. Download the HBV sequences of genotypes A-J were obtained from GenBank (n>8000) (https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/).
2. Design a consensus sequence based on 50% threshold per each genotype. Annotate the conserved and parsimony informative sites.
3. Use Primal scheme (https://primalscheme.com) to design the primers and the Amplicon-size was set at 1200.
4. Compare the variable regions and select the putatively universal primers.
5. To avoid any primer dropouts, add the other variable primers. These can be used to spike the master mix during PCR.
| A | B | C | |
| Primer Name | Sequence | Positions | |
| SC_1_LEFT | TTC CAC CAA GCT CTG CAA GATC | 11 - 32 | |
| SC_1_RIGHT | AGAGGAATATGATAAAACGCCGCA | 384-407 | |
| SC_2_LEFT | CATCATCATCAT CACCA CCTCC | 325-346 | |
| SC_2_RIGHT | AAAGCCCTACGAACCACTGAAC | 692-713 | |
| SC_3_LEFT | AAATACCTATGGGAGTGGGCCT | 632-653 | |
| SC_3_RIGHT | TTGTGTAAATGGAGCGGCAAAG | 1 655-1 676 | |
| SC_4_LEFT | AGAAAACTTCCTGTTAACAGACCTATTG | 949-976 | |
| SC_4_RIGHT | GGACGACAGAATTATCAGTCCCG | 1 326-1 348 | |
| SC_5_LEFT | TCCATACTGCGGAACTCCTAGC | 1 265-1 286 | |
| SC_5_RIGHT | TGTAAGACCTTGGGCAGGATTTG | 1 632-1 654 | |
| SC_6_LEFT | CTTCTCATCTGCCGGTCCGTGT | 1 559-1580 | |
| SC_6_RIGHT | AGA AGT CAG AAG GCA AAC GAGA | 1 947-1 970 | |
| SC_7_LEFT | GGCTTTGGGGCATGGACATT | 1 890-1 909 | |
| SC_7_RIGHT | ATCCACACTCCGAAAGAGACCA | 2 256-2 277 | |
| SC_8_LEFT | GACAACTATTGTGGTTTCATATTTCT | 2 193-2 218 | |
| SC_8_RIGHT | TTGTTGACACCTATTAATAATGTCCTCA | 2 576-2 594 | |
| SC_9_LEFT | TGGGCTTTATTCCTCTACTGTCCC | 2 492-2 515 | |
| SC_9_RIGHT | GGGAACAGAAAGATTCGTCCCC | 2 889-2 910 | |
| SC_10_LEFT | TTGCGGGTCACCATATTCTTGG | 2 816-2 837 | |
| SC_10_RIGHT | GGCCTGAGGATGACTGTCTCTT | 3 189-3 210 |
Table1: Primers for Pool 1 & 2. Pool One are odd Numbers (SC_1, SC_3, ...) and Pool two are even Numbers (SC_2, SC_4,..)
Reconstitution of Primer Pools
To ensure proper primer dilution and pooling, follow these steps in a clean master-mix hood start by decontaminating of the working area (PCR hood/cabinet ).
1. Prior to use, decontaminate the master-mix hood using 10% bleach and 70% ethanol.
2. Sterilize the master-mix hood by exposing it to ultraviolet (UV) light for00:15:00 .
15m
Depending on the nature of the primers (lyophilised/or solution); if required, re-suspend lyophilised primers at a concentration of 100 µM each using nuclease-free water.
**Adhere to the primer reconstitution instructions provided by the supplier or manufacturer.**
1. To create a 100 µM stock of the primer pool for Pool 1, combine 5 µL of Pool 1 with 485 µL of nuclease-free water in a labeled 1.5 mL Eppendorf tube called "Pool 1 (100 μM)". This will yield a total volume of 490 µL , resulting in a 100 µM concentration of the primer pool stock.
2. Repeat the above procedure to create 100 M of primer pool for Pool 2.
Note
Primers should be diluted and pooled in the mastermix cabinet which should be cleaned with decontamination wipes and UV sterilised before for 00:15:00 and after use.
For each 100μM primer pool (1 & 2), dilute 1:10 in molecular grade water, to generate 10 µM primer stocks. Make several aliquotes for each primer pool in case of degradation or contamination.
Note
To achieve a final concentration of 0.015µM per primer in a 25 µL reaction, the following modifications can be made:
For pool 1, which consists of 5 primers:
- The required volume of the 10µM primer stock is calculated as follows:
(0.015µM) x (25µL) / (10µM) =0.0375 µL
- Rounding up to 0.04µL, the volume of primer pool 1 to be added is adjusted to 1.1 µL .
For pool 2, which consists of 5 primers:
- Using the same calculation as above:
(0.015µM) x (25µL) / (10µM) = 0.0375 µL
- Rounding down to 0.03µL, the volume of primer pool 2 to be added is adjusted to 1.1 µL .
By rounding both volumes to 1.1 µL for both pools, they can be prepared in a similar fashion. If you are using a different primer pool scheme, adjust the volume accordingly.
Tiling Polymerase chain reaction (PCR)
To ensure contamination free master-mixes start by decontaminating all the working area in the clean room including workbench and the master mix hood.
#*1. Decontaminate the master-mix hood using 10% bleach and 70% ethanol.
#*2. Sterilize the mastermix hood by exposing it to ultraviolet (UV) light for 00:15:00 .
15m
Each sample requires two PCR reactions (1 for each primer pool, to be combined later).
1. Arrange the PCR reactions for each sample in strip-tubes or plates according to the following instructions.
2. Mix the following components in a labeled 1.5ml eppendorf tube. Combine other reagents/components except the template as master-mix and divide into aliquots before adding DNA.
3. Mix gently by pipetting and briefly spin the tube to ensure the liquid collects at the bottom.
| A | B | C | |
| Component | PCR 1 | PCR 2 | |
| Q5 2x Master Mix | 12.5 μL | 12.5 μL | |
| Primer pool 1 (10µM) | 1.1 μL | - | |
| Primer pool 2 (10µM) | - | 1.1 µL | |
| Nuclease-free water | 8.9 μL | 8.9 µL | |
| DNA template | 2.5 µL | 2.5 µL | |
| Total Volume | 25µL | 25µL |
Table 2. PCR mastermix
In clean MasterMix cabinet:
1. Add 12.5 µL 5X Q5 Reaction Buffer to a labeled 1.5ml eppendorf tube.
2. Add1.1 µL Primer Pool 1 or 2 (10μM) to the 1.5ml Eppendorf tube containing 12.55 µL 5X Q5 Reaction Buffer.
3. Add8.9 µL of Nuclease free-water to the 1.5ml eppendorf mixture. The total volume should now be 25 µL
4. Aliquot the 22.5 µL of master-mix in labelled PCR strip tubes and transfer the master-mixes to the decontaminated#* extraction hood.
In the extraction and sample addition cabinet:
- Add 2.5 µL of DNA template into the master-mixes, both pool 1 and 2. After adding; mix well by pipetting.
- Add 2.5 µL each DNA sample to a tube containing 22.5 µL Pool1.
- Add 2.5 µL each DNA sample to a tube containing 22.5 µL Pool 2.
2. Carefully mix the contents by pipetting in a gentle manner, and pulse centrifuge the tubes to collect the contents at the bottom of the tube.
Note
NB* : Maximum cation is required to avoid contamination.
Note: To prevent pre-PCR contamination the master-mix for each pool should be made up in the master-mix cabinet, which should be cleaned with decontamination wipes and UV sterilised for 00:15:00 before and after use and aliquoted into PCR strip-tubes/plate.
Store residual samples at -80 °C to maintain DNA integrity.
- Incubate both PCR reactions in a thermocycler with the following settings:
| A | B | C | |
| Heat Activation | 98°C | 30 seconds | |
| Denaturation | 98°C | 15 seconds | |
| Annealing | 65°C | 5 minutes | |
| Repeat denaturation and annealing for a total of 25 cycles | |||
| Hold | 4°C | ∞ |
Tabe 3: Tiling PCR conditions
Expected result
Final concentrations of PCR products typically range from ~5 - 150ng/ul as measured by Qubit.
Pooling and PCR quantification
Label a 1.5 mL Eppendorf tube for each sample.
Transfer and merge all the components from the "Pool 1" and "Pool 2" PCR reactions of each biological sample into a single 1.5 mL Eppendorf tube, ensuring that all the contents are from sample. ** Avoid mixing samples**
Component Volume
Pool 1 PCR reaction 10 µL
Pool 2 PCR reaction 10 µL
Total 20 µL
Note
It is crucial to exercise caution and follow proper laboratory practices when handling amplified PCR products. To ensure the integrity of your samples and prevent contamination, adhere to the following guidelines:
- Designate a separate post-PCR workspace: Set up a dedicated area separate from where primers and master mixes are handled. Ideally, this space should be physically isolated or located in a different room to minimize the risk of contamination.
- Equip the workspace appropriately: Outfit the post-PCR workspace with equipment solely dedicated to handling PCR products. This includes pipettes, centrifuges, and any other necessary instruments. Avoid using equipment that may have come into contact with primers or master mixes to prevent cross-contamination.
- Take precautions during tube handling: When working with PCR tubes containing amplified products, open them only within the designated post-PCR workspace. Be mindful of not spilling or splashing the contents, as this could lead to contamination.
- Use separate lab coats, gloves, and other personal protective equipment (PPE): Designate specific lab coats, gloves, and other PPE items for use in the post-PCR workspace. This prevents the transfer of contaminants between different areas of the laboratory.
By maintaining a separate workspace and adhering to these precautions, you can minimize the risk of contamination and ensure the reliability of your PCR results.
An alternative application for these amplicons is Oxford Nanopore Sequencing, specifically using Josh Quick's ligation-based protocol outlined in the CoV-2019 sequencing protocol v2. This protocol can be found at
Citation
LINK
To quantify the DNA, it is recommended to use a Qubit or any other suitable method. Nanodrop is not recommended for this purpose. However, if you do not have access to a Qubit or prefer to save time and costs, you may choose to omit this quantification step.
See
Visualising the size of amplicons using the LabChip Fragment Analyzer.
"To add the lab chip preparation protocol"
Rapid barcoding using the RBK110.96 kit for 96 samples
To accommodate multiple samples on the same flow cell, barcoding can be employed. Using the RBK110.96 kit, it is possible to run up to 96 samples simultaneously. Each sample's amplicons will be individually barcoded in the subsequent steps. It is strongly advised to refer to the current Oxford Nanopore Protocol for detailed instructions on these steps. As a tip, you can aliquot the Rapid barcodes into a PCR strip to facilitate multi-channeling. For comprehensive information, please consult the appropriate documentation.
Citation
LINK
Add 7.5 µL of each diluted PCR reaction from step 15 to the labeled PCR tube.
Set up the following reaction for each sample:
Component Volume
DNA amplicons from step 15 (100ng total) 7.5 µL
Fragmentation Mix RB01-12 (one for each sample, included in kit) 2.5 µL
Total 10 µL
NB* Mix gently by flicking the tube, and spin down.
Incubate the reaction in a thermocycler with the following settings:
| A | B | |
| 20°C | 20 minutes | |
| 65°C | 10 seconds | |
| 4°C | 1 minute |
TABLE 4:
Note: All PCR products now contain DNA barcodes that will be resolved during the sequencing process.
Rapid barocoding using the SLK RBK109
Pool all barcoded samples, noting the total volume.
Add an equal volume (1:1) of Ampure beads to the pooled sample tube and mix gently by either flicking or pipetting.
Pulse centrifuge to collect all liquid at the bottom of the tube.
Incubate for 00:05:00 at Room temperature.
Place on magnetic rack and incubate for or until the beads have pelleted and the supernatant is completely clear.
Carefully remove and discard the supernatant, being careful not to touch the bead pellet.
Add 200 µL of freshly prepared 70% ethanol (at room temperature) to the pellet. Take caution to avoid touching the bead pellet. Remove the ethanol carefully and discard it.
Repeat Step above.
Centrifuge the tube briefly in pulses to ensure that all the liquid gathers at the bottom. Subsequently, using a P10 pipette, cautiously extract as much residual ethanol as possible from the tube.
Leave the tube lid open and incubate for 1 minute or until the pellet loses its shine.
NB*It is important to note that if the pellet dries completely, it may crack and become challenging to resuspend.
Resuspend pellet in 30 µLElution Buffer (EB), mix gently by either flicking or pipetting and incubate for 00:02:00.
Place on magnetic stand and transfer sample to a clean 1.5mL Eppendorf tube ensuring no beads are transferred into this tube.
Measure the concentration of samples using Qubit. (See Section 1).
MinION NGS sequencing
Prepare the flow-cells for sequencing. Prime the flow cell and add the priming fluid as recommend.
Start the sequencing run using MinKNOW latest version.