Nov 02, 2021
CHEM 584--Cloning sgRNA Sequences into lentiCRISPRv2
This protocol is a draft, published without a DOI.
- 1Brigham Young University
Protocol Citation: Ken Christensen 2021. CHEM 584--Cloning sgRNA Sequences into lentiCRISPRv2. protocols.io https://protocols.io/view/chem-584-cloning-sgrna-sequences-into-lenticrisprv-bznyp5fw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: November 01, 2021
Last Modified: November 02, 2021
Protocol Integer ID: 54712
Abstract
This protocol describes how to clone your chosen sgRNA sequence into the lentiCRISPRv2 plasmid. A method to validate your cloning is also included here.
Design and Order Guide Sequences
Design and Order Guide Sequences
Design and order sgRNA sequence oligonucleotides based on your previously identified target sequences.
Oligo 1: 5'-CACCGNNNNNNNNNNNNNNNNNNNN
Oligo 2: 3'- CNNNNNNNNNNNNNNNNNNNNCAAA
Important Note: Do not include the NGG PAM in your designed oligonucleotides
lentiCRISPRv2 Digestion
lentiCRISPRv2 Digestion
Digest 2 µg of lentiCRISPRv2 plasmid with BsmBI overnight at 55°C:
Set up the following reaction:
2.5 µl 10X NEB r3.1 Buffer
x µl ddH2O to make up 25 µl final volume
1 µl BsmBI
2 µg lentiCRISPRv2 plasmid*
*Add the plasmid last, into the reaction mixture, pipette gently to mix and spin briefly.
Gel Purify the Digested Plasmid
Gel Purify the Digested Plasmid
Use the Zymoclean Gel DNA Recovery kit to gel purify the digested plasmid.
A ~2 kb filler piece should be present on the gel. Only purify the larger band. Leave the ~2 kb band.
Anneal the oligonucleotides
Anneal the oligonucleotides
Suspend the oligonucleotides at 100 µM in autoclaved ddH2O
Set up annealing reaction:
2 µl Oligo 1
2 µL Oligo 2
2 µl 10X T4 Ligation Buffer (NEB)
14 µl ddH2O
Anneal the oligonucleotides in a thermocycler:
95°C for 5 min
Ramp temperature down to 25°C at 5°C/min
Dilute annealed oligonucleotides 1:200 with autoclaved ddH2O (1 µl annealed oligo pair + 199 µl water).
Ligation into lentiCRISPRv2
Ligation into lentiCRISPRv2
Set up the ligation reaction and incubate at 16°C overnight (with the 2X Instant Stick End Master Mix, you may be able to significantly shorten this incubation).
x µl digested plasmid (50 ng)
1 µl diluted oligonucleotide duplex
6 µl 2X Instant Sticky End Master Mix
x µl ddH2O to make a final volume of 12 µl
Transform into NEB STBL competent cells
Transform into NEB STBL competent cells
Add up to 5 µl of your ligation reaction into NEB STBL Mix & Go component cells following the Mix & Go Competent Cell protocol. Plate your cells on Amp/Carb plates.
Use Colony PCR to screen for the presence of cloned oligo pairs
Use Colony PCR to screen for the presence of cloned oligo pairs
Use the Colony PCR protocol to screen for the presence of cloned oligo pairs using the 2X TaqDog Master Mix.
Run 10-20 µl of your PCR products on a 0.8% agarose gel. Use the 100 bp ladder for your gel.
Primers (provided):
lentiCRISPRv2 For: GTGGAAAGGACGAAACACCG
lentiCRISPRv2 Rev: CTAGGCACCGGATCAATTGC
Expected amplicon for positive clones = 248 bp
Isolate plasmid for positive clones
Isolate plasmid for positive clones
Prepare overnight cultures for positive clones.
Purify plasmid from overnight cultures using the Zymo Plasmid Miniprep-Classic protocol.
Sequence positive plasmids
Sequence positive plasmids
Send plasmid for Sanger Sequencing (Eton Biotechnology).
Sequencing primer:
hU6-F: GAGGGCCTATTTCCCATGATT