Sep 07, 2022

Cell line construction and maintenance for Lyso-IP with or without genes linked with lysosomal storage disease

  • 1Harvard Medical School;
  • 2Department of Cell Biology, Harvard Medical School Boston, MA 02115, USA;
  • 3Aligning Science Across Parkinson's (ASAP) Collaborative Research Network, Chevy Chase, MD 20815, USA
Icon indicating open access to content
QR code linking to this content
Protocol CitationSharan Sharan Swarup, Harper JW 2022. Cell line construction and maintenance for Lyso-IP with or without genes linked with lysosomal storage disease. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2oxqqv1y/v1
Manuscript citation:
Boland, S., Swarup, S., Ambaw, Y.A. et al. Deficiency of the frontotemporal dementia gene GRN results in gangliosidosis. Nat Commun 13, 5924 (2022). https://doi.org/10.1038/s41467-022-33500-9
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 16, 2022
Last Modified: May 31, 2024
Protocol  Integer ID: 68719
Keywords: ASAPCRN, lysosomal storage disease lyso, lysosomal storage disease, isolation of lysosome, lysosome, maintenance of hela cell, hela cell, deletion of gene, cell line construction, methods for cell line construction, proteomic, cell line, cell, metabolomic, maintenance for lyso, gene
Funders Acknowledgements:
ASAP
Grant ID: 000282
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Lyso-IP is a method that allows for the isolation of lysosomes for proteomics and metabolomics using HA-tagged TMEM192 (dx.doi.org/10.17504/protocols.io.bybjpskn; dx.doi.org/10.17504/protocols.io.bx9hpr36). Here, we describe methods for cell line construction and maintenance of HeLa cells with TMEM192-3xHA with or without deletion of genes linked with lysosomal storage diseases.
Materials
ABC
REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins
Puromycin Sigma-Aldrich P9620
G418 (Geneticin) Invivogen ant-gn-2
Dulbecco’s MEM (DMEM), high glucose, pyruvate GIBCO / Invitrogen 11995
Experimental models: Cell lines
HeLa cells ATCC CCL-2
HeLa: TMEM192-3xHA This study
Recombinant DNA
pSMART TMEM192-3xHA (targeting vector for genomic tagging) 35 Addgene #175777
pX459-gRNA-APP (for making APP deletion by CRISPR/Cas9) This study Addgene #176487
Cell line maintenance
Maintain HeLa cells in Dulbecco’ Modifies Eagles Medium (DMEM) with 10% fetal bovine serum and optional 1% penicillin-streptomycin.
Endogenous tagging of TMEM192 with 3xHA
For endogenous tagging of TMEM192 with 3xHA, co-transfect HeLa cells with pX459 containing a gRNA (5’-AGTAGAACGTGAGAGGCTCA) targeting adjacent to the translational termination sequence in TMEM192 and pSMART containing 5’ and 3’ homology arms for TMEM192 in which the termination codon is replaced by a 3xHA epitope sequence followed by a TAA stop codon (Addgene #175777).
Identify homozygously targeted clones by immunoblotting cell extracts with α-HA and α-TMEM192. These are referred to as HeLa-TMEM192-HA cells for Lyso-IP.
Targeted knock-out specific genes including GRN, HEXA, NPC1 and NPC2
For GRN knock-out, phosphorylate and anneal oligonucleotides (Top: 5’- ATCGACCATAACACAGCACG, Bottom: 5’-CGTGCTGTGTTATGGTCGAT), and clone into a pX459 vector. For HEXA knock-out, phosphorylate and anneal oligonucleotides (Top: 5’- CGGCCGAGCTGACATCGTAC, Bottom: 5’-GTAGCATGTCAGCTCGGCCG), and clone into a pX459 vector. For NPC1 knock-out, phosphorylate and anneal oligonucleotides (Top: 5’- TACCTGGACAGAAACTGTAG, Bottom: 5’-CTACAGTTTCTGTCCAGGTA), and clone into a pX459 vector. For NPC2 knock-out, phosphorylate and anneal oligonucleotides (Top: 5’- AGCTGCCAGGAAACGCATCG, Bottom: 5’-CGATGCGTTTCCTGGCAGCT), and clone into a pX459 vector.
Transfect HELA-TMEM192-HA cells with the pX459-gRNA-APP plasmid (Addgene #176487) with Lipofectamine 3000, and select with 1.2 µg/mL of puromycin. Select monoclonal cells, and confirm target gene deletion by Western blotting, and/or Sanger sequencing of the edited alleles.
Rescue of GRN expression
The entry vector pDONR223 containing full-length GRN open reading frame (1179 base pairs) is recombined with a pHAGE lentivirus destination vector using Gateway cloning technology (Thermo Fisher).
Make lentivirus for transduction of pHAGE-GRN by transfecing 293T cells along with psPAX2, pMD2.G (Addgene Cat#12260 Cat#12259) and pHAGE-GRN in a 4:2:1 ratio using polyethyleneimine. Virus-containing supernatant was harvested 2 days after transfection and filtered through a 0.45-micron syringe filter. Polybrene was added to a final concentration of 8 mg/ml to the viral supernatant.
HeLa Tmem192-3xHA GRN KO cells were infected with 50 mL of viral supernatant, and stable cell lines were selected 48 h post-infection using hygromycin at a concentration of 100 mg/mL.
Maintain HeLa cells in Dulbecco’ Modifies Eagles Medium (DMEM) with 10% fetal bovine serum and optional 1% penicillin-streptomycin with hygromycin at a concentration of 100 mg/mL.