Jun 11, 2026

Bundibugyo ebolavirus qPCR Taqman duplex assay (Bundibugyo + human internal control)

  • Elyse Stachler1,
  • Kyle McMahon1,
  • Stella Nielsen1,
  • Hannah Knoll1,
  • Colby Wilkason1,
  • Al Ozonoff1,
  • Pardis Sabeti1
  • 1Broad Institute of MIT and Harvard
  • Diagnostic Assay Protocols
Icon indicating open access to content
QR code linking to this content
Protocol CitationElyse Stachler, Kyle McMahon, Stella Nielsen, Hannah Knoll, Colby Wilkason, Al Ozonoff, Pardis Sabeti 2026. Bundibugyo ebolavirus qPCR Taqman duplex assay (Bundibugyo + human internal control). protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg3r4e1g25/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 04, 2026
Last Modified: June 11, 2026
Protocol  Integer ID: 318544
Keywords: bundibugyo ebolavirus qpcr taqman duplex assay, bundibugyo ebolavirus, outbreak of bundibugyo ebolavirus, zaire ebolavirus, sudan ebolavirus viral rna, sudan ebolavirus, taqman qpcr assay, bundibugyo viral rna, rapid bdbv detection, singleplex taqman assay, quantitative pcr assay, whole viral rna, viral rna, human internal control assay, developed assay, assay, quantitative pcr, outbreak, critical need for reliable diagnostic tool, clinical diagnostic, bdbv, sybr qpcr, public health emergency of international concern, qpcr, reliable diagnostic tool
Abstract
In May 2026, an outbreak of Bundibugyo ebolavirus in the Democratic Republic of the Congo was declared a Public Health Emergency of International Concern (PHEIC) by the World Health Organization (WHO), rapidly elevating public health concerns. This has underscored the critical need for reliable diagnostic tools. In this paper, we present the development and initial validation of a quantitative PCR assay specifically designed for rapid BDBV detection. We present protocols to run this assay as a singleplex SYBR assay, a singleplex TaqMan assay, or a duplex TaqMan assay combined with a human internal control assay. The developed assay was validated on synthetic gene fragments, whole viral RNA, and contrived clinical samples. Analytical evaluation demonstrates high performance, with a limit of detection (LOD) of 5 copies/reaction as a TaqMan qPCR assay and 50 copies/reaction as a SYBR qPCR assay. In addition, the assays accurately detected Bundibugyo viral RNA and did not detect Zaire ebolavirus or Sudan ebolavirus viral RNA. These results indicate that our quantitative PCR assay provides a highly sensitive, specific, and versatile detection modalities to support outbreak surveillance and clinical diagnostics.
Guidelines
Patient blood/serum/plasma collection and testing for this protocol requires prior approval by the users' Institutional Ethics Board or equivalent ethics committee.
Materials
- Luna® Probe One-Step RT-qPCR Kit (No ROX) Protocol (NEB# E3007)
- General lab plastics (qPCR plates, microcentrifuge tubes, etc.)
- Primers and probes:


NameSequence (5' > 3')FluorophoreFinal Assay Concentration (nM)
Bundi_FPTAACTCATCCACAGACCCCA-400
Bundi_RPGATGGCGCCGAAACTATAGA-400
Bundi_PCTCACATATCCTAAGGTTGGGCTCCFAM200
mcirDNA_FPGACCCACCAATCACATGC-400
mcirDNA_RPTGAGAGGGCCCCTGTTAG-400
mcirDNA_PAGTAAAACCCAGCCCATGACCCHEX200
Bundi_gblockgaaatTAATACGACTCACTATAgggTACCTAACCTACACGTCTACGCTTTCCTTGGATCTCACAAGGTACCGAGAGAATGAGTTAATTTATGATAACAATCCGTTAAAAGGTGGACTTAATTGCAACCTATCCTTTGATAATCCACTTTTCAAGGGCCAAAGGCTCAATATCATAGAGGAGGATTTGATTAGATTTCCTCATCTATCTGGGTGGGAACTTGCGAAAACCATCATTCAGTCCATTATCTCAGACAGCAATAACTCATCCACAGACCCCATTAGCAGTGGAGAAACACGATCATTCACAACTCACTTTCTCACATATCCTAAGGTTGGGCTCCTCTATAGTTTCGGCGCCATCGTGAGTTATTACTTAGGGAATACCATTATTAGGACCAAAAAGCTAGACCTCAGTCATTTTATGTATTACTTAACAACTCAAATCCATAATTTGCCACATCGCTCGTTGAGGATACTTAAGCCCACCTTTAAACATGTTAGTGTGATATCAAGACTAATGAGTAT--
mcirDNA_gblockTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGTCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTA--


Before start
- Any One-Step RT-qPCR kit should be compatible with the below protocol. If using a different kit than the one listed, be sure to first validate a standard curve before running patient samples. The protocol/cycling conditions may need to be updated to be compatible with the available kit.
- The assay should be compatible with any chosen fluorophore. Ensure you choose a fluorophore compatible with the qPCR machine you are using.
- This protocol requires nucleic acid extraction from plasma prior to running the qPCR. While the protocol is validated for extracted plasma, extraction from whole blood or serum will likely be compatible. A test to check for PCR inhibition should be done before using a sample matrix other than plasma.
Protocol
Thaw qPCR mastermix, primers, and probes at room temperature. After components are thawed, briefly mix by inversion or gentle vortexing. Briefly centrifuge or flick the tube to collect liquid at the bottom before opening the tubes.
Prepare Probe and Primer Mix (PPM) Stocks according to the following recipe (can be multiplied to make a large volume and frozen into smaller volume aliquots). One PPM should be made for each of Bundibugyo and mcirDNA:

AB
PPMsµL
FP (100µM)10
RP (100µM)10
Probe (100µM)5
Water or Buffer75
Total100

Prepare enough master mix according to the table below. The table accounts for plating triplicate 10µL reactions per sample and includes overage. If running a standard curve, ensure these are included in the sample count. Minimally, run a positive control and a no template control (NTC) per plate.


ABCD
Component30µL rxnOverageTotal to make (for 8 rxns)
Luna Universal Probe One-Step Reaction Mix (2X)15.0018.00172.80
Luna WarmStart® RT Enzyme Mix (20X)1.501.8017.28
Bundi PPM1.201.4413.82
mcirDNA PPM1.201.4413.82
Template RNA3.003.60-
Nuclease-free Water8.109.7293.31
TOTAL:30.0036.00311.04

Gently mix mastermix and spin down to ensure uniformity. Aliquot 32.4µL of mastermix per well in a 96-well plate according to the number of samples being run.
Pipette 3.6µL of extracted plasma (or positive control material or water for an NTC).
Gently vortex and spin down plate.
Pipette triplicate 10µL reactions into a 96-well or 384-well plate. Seal plate with an optical seal compatible with the qPCR machine being used.
Briefly spin plate to collect liquid at the bottom.
Program the qPCR machine according to the following:
Reaction volume: 10µL
Fluorophores: FAM, HEX
Ensure there is a plate read step at the end of each extension cycle
Cycling conditions:


ABCD
StepTemperature (℃)TimeCycles
Reverse Transcription5510 minutes1
Initial Denaturation951 minute1
Denaturation9510 seconds40
Annealing and Extension6030 seconds