Jan 29, 2026
Bulk ATAC-seq
- Boxun Li1,
- Alexias Safi1,
- Greg Crawford1,
- Charles Gersbach1
- 1Duke University
- Gersbach Lab
Protocol Citation: Boxun Li, Alexias Safi, Greg Crawford, Charles Gersbach 2026. Bulk ATAC-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk1md6g5r/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 26, 2026
Last Modified: January 29, 2026
Protocol Integer ID: 241573
Keywords: ATAC-seq, iPSC derived neurons, astrocytes, performing bulk atac, bulk atac, seq on ipsc, mouse primary astrocyte, primary astrocyte, seq this protocol, seq, derived neuron, ipsc
Funders Acknowledgements:
NIH
Grant ID: HG012053
Disclaimer
This protocol was adapted from the work of Boxun Li and Alexis Safi in the Gersbach lab at Duke University.
Abstract
This protocol describes methods for performing bulk ATAC-seq on iPSC-derived neurons and mouse primary astrocytes.
Materials
KnockOut Serum Replacement (Gibco, 10828010)
dimethyl sulfoxide (Sigma-Aldrich, D8418)
Zymo DNA Clean up Kit (#11-303C)
NEBNext High-Fidelity 2x PCR Master Mix (New England Labs Cat #M0541)
100x SYBR Green I* (Invitrogen Cat #S-7563)
Troubleshooting
Cell Preparation
Grow and dissociate neuron and astrocyte monocultures and neuron-astrocyte co-cultures (according to previous protocols Ngn2 neuron differentiation [Ref. 2], and 3.Neuron dissociation [Ref. 3]) to neuronal maturation Day 3, 7, 14, and 28 (i.e., co-culture Day 2, 6, 13, and 27). Viably freeze dissociated single cells in 90% KnockOut Serum Replacement (Gibco, 10828010) + 10% dimethyl sulfoxide (Sigma-Aldrich, D8418).
Upon completion of sample collection, thaw frozen vials from various time points together at 37C. Use approximately 100,000-500,000 cells for ATAC-seq library preparation. Cells were washed with warm Neuronal Maturation Medium (detailed in protocol Ngn2 neuron differentiation [Ref.2]). Centrifuge cells for 5 mins at 1000 rpm. Wash with 1mL cold 1X PBS. Centrifuge again for 5 mins at 1000 rpm.
Resuspend pellet with 1mL of cold ATAC-seq resuspension buffer (RSB; 10 mM Tris-HCl pH 7.4, 10 mM NaCl, and 3 mM MgCl2 in water) + 0.1% Tween. Transfer to 1mL dounce homogenizer.
Give 10 stokes with tight pestle. Transfer to Eppendorf tube.
Spin down at 500 ×g for 10 min, 4°C.
Aspirate all supernatant, carefully avoiding visible cell pellet, using two pipetting steps. Suspend nuclei pellet in 27ul 2X TD Buffer by pipetting up and down 5 times. Use 2ul to count nuclei (10ul trypan blue+2ul nuclei suspension+8ul water). If nuclei are too concentrated to accurately count, dilute further with 2X TD Buffer. Adjust 50,000 nuclei to 25ul total using 2X TD Buffer.
[2X TD Buffer: 20mM Tris-HCl pH7.6, 10mM MgCl2, 20% Dimethyl Formamide]
Transposition Reaction and Purification
Make sure the cell pellet is set on ice.
To make the transposition reaction mix, combine the following (prepare a master mix) then add 25ul to each sample:
2.5 μL Tn5 Transposase (#200341970)
16.5 μL 1X PBS
0.5 μL 10% Tween-20
0.5 μL 1% Digitonin (Invitrogen #BN2006)
5 μL Nuclease Free H2O
50 μl Total reaction volume
Using wide bore tip, gently pipette 3 times to mix nuclei suspension with the transposition reaction mix.
Incubate the transposition reaction at 37°C for 30 min in a thermomixer with 1000 RPM mixing.
Immediately following transposition, purify using a Zymo DNA Clean up Kit (#11-303C).
Elute transposed DNA in 21 μL Elution Buffer (10mM Tris buffer, pH 8).
Purified DNA can be stored at -20°C.
PCR Amplification
To amplify transposed DNA fragments, combine the following in a PCR tube:
20 μL Transposed DNA
2.5 μL 25μM Customized Nextera PCR Primer 1*
2.5 μL 25μM Customized Nextera PCR Primer 2*
25 μL NEBNext High-Fidelity 2x PCR Master Mix (New England Labs Cat #M0541)
50 μL Total
*Complete list of primers available in Indexes of this protocol
Cycle as follows:
(1) 72°C, 5 min
(2) 98°C, 30 sec
(3) 98°C, 10 sec
(4) 63°C, 30 sec
(5) 72°C, 1 min
(6) Repeat steps 3-5, 4x
(7) Hold at 4°C
Remove tubes from thermocycler and store on ice. Proceed to qPCR amplification to determine additional cycles immediately. To run a qPCR side reaction, combine the following:
5 μL 5 cycles PCR amplified DNA
4 μL Nuclease Free H2O
0.5 μL 50μM Customized Nextera PCR Primer 1
0.5 μL 50μM Customized Nextera PCR Primer 2 (Barcode)
0.06 μL 100x SYBR Green I* (Invitrogen Cat #S-7563)
10 μL NEBNext High-Fidelity 2x PCR Master Mix
20 μL Total
*10,000x SYBR Green I is diluted in 10mM Tris buffer, pH 8 to make a 100x working solution
qPCR cycle as follows:
(1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 63°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, 19x
(6) Hold at 4°C
After qPCR amplification, manually assess the amplification profiles and determine number of additional cycles to amplify. See Buenrostro et al 2015 (Ref. 4) for a detailed explanation. The additional number of cycles needed for the remaining 45 μL PCR reaction is determined as following:
(1) Plot linear Rn vs. Cycle
(2) Calculate the # of cycle that corresponds to 1⁄4 of maximum fluorescent intensity
Using the remaining 45 μL PCR reaction, run the required number of additional cycles. Most libraries will need 4-8 additional cycles. Anything needing more than 15 additional cycles should be considered as failed. Place the pre-amplified tubes back in the thermocycler without addition of any more reagents. Cycle as follows:
1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 63°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, x times
(6) Hold at 4°C
Purify amplified library using 1.2X ratio of Ampure XP beads. Elute the purified library in 20 μL Elution Buffer (10mM Tris Buffer, pH 8).
The workflow for the PCR purification process is as follows:
1. Add 1.2 μL AMPure beads per 1.0 μL of sample (50μl for a 45μl PCR reaction).
2. Transfer to eppendorf tube and mix 10 times. Incubate 10min at RT to bind DNA fragments to paramagnetic beads.
3. Add magnet and wait until solution clears, about 5 min.
4. Wash beads + DNA fragments twice with fresh 80% Ethanol to remove contaminants. With beads on magnet, add 200μl EtOH (or enough to cover the beads), leave 30 seconds, remove all EtOH. Repeat once. Air dry beads 2-3min at RT, no more than 5 min.
5. Elute purified DNA fragments from beads. Remove magnet and suspend beads with 20 μl of 10mM Tris, pH 8. Mix10 times. Incubate 5 min then separate with magnet.
6. Transfer to new tube.
Indexes
A full list of Illumina adapters can be found at
Nextera DNA indexes (page 16-17)
N701: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
N702: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
N703: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
N704: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
N705: CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
N706: CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
N707: CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
N708: CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
N501: AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTG
N502: AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTG
N503: AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCGTCGGCAGCGTCAGATGTG
N504: AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCGTCGGCAGCGTCAGATGTG
N505: AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTCGGCAGCGTCAGATGTG
N506: AATGATACGGCGACCACCGAGATCTACACACTGCATATCGTCGGCAGCGTCAGATGTG
N507: AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTCGGCAGCGTCAGATGTG
N508: AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCGTCGGCAGCGTCAGATGTG
Protocol references
1. Corces MR, Trevino AE, Hamilton EG, Greenside PG, Sinnott-Armstrong NA, Vesuna S, Satpathy AT, Rubin AJ, Montine KS, Wu B, Kathiria A, Cho SW, Mumbach MR, Carter AC, Kasowski M, Orloff LA, Risca VI, Kundaje A, Khavari PA, Montine TJ, Greenleaf WJ, Chang HY. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods. 2017 Oct;14(10):959-962. doi: 10.1038/nmeth.4396. Epub 2017 Aug 28. PMID: 28846090; PMCID: PMC5623106.
2. Li B, Gersbach CA. Excitatory neuron differentiation from inducible Ngn2 iPSCs (WTC11). https://www.protocols.io/view/excitatory-neuron-differentiation-from-inducible-n-ewov1kqxpgr2/v1
3. Li B, Gersbach CA. Neuron dissociation protocol for single-cell sequencing applications. https://www.protocols.io/view/neuron-dissociation-protocol-for-single-cell-seque-j8nlk1or5g5r/v1
4. Buenrostro JD, Wu B, Chang HY, Greenleaf WJ. ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide. Curr Protoc Mol Biol. 2015. PMID: 25559105
Acknowledgements
This protocol was adapted from: Corces MR, Trevino AE, Hamilton EG, Greenside PG, Sinnott-Armstrong NA, Vesuna S, Satpathy AT, Rubin AJ, Montine KS, Wu B, Kathiria A, Cho SW, Mumbach MR, Carter AC, Kasowski M, Orloff LA, Risca VI, Kundaje A, Khavari PA, Montine TJ, Greenleaf WJ, Chang HY. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods. 2017 Oct;14(10):959-962. doi: 10.1038/nmeth.4396. Epub 2017 Aug 28. PMID: 28846090; PMCID: PMC5623106.