Oct 02, 2025

Blunt-End-Single-Tube (BEST): Adapter Hybridization

Ecology and Evolution
DOI
https://dx.doi.org/10.17504/protocols.io.j8nlkym4wg5r/v1
  • 1University of Copenhagen
  • Lorenzen Lab
Vanssy Li
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.j8nlkym4wg5r/v1
External link: https://doi.org/10.1111/2041-210X.12871
Protocol Citation: Michael V. Westbury, Alba Rey-Iglesia, Deon de Jager, Vanssy Li, Eline D. Lorenzen 2025. Blunt-End-Single-Tube (BEST): Adapter Hybridization. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlkym4wg5r/v1
Manuscript citation:
Carøe, C., Gopalakrishnan, S., Vinner, L., T. Mak, S. S., S. Sinding, M. H., Samaniego, J. A., Wales, N., Sicheritz-Pontén, T., & P. Gilbert, M. T. (2018). Single-tube library preparation for degraded DNA. Methods in Ecology and Evolution, 9(2), 410-419. https://doi.org/10.1111/2041-210X.12871
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 18, 2025
Last Modified: October 02, 2025
Protocol  Integer ID: 227597
Keywords: Ancient DNA, Library Build, Adapter Hybridazation, BEST, tube library preparation for degraded dna, tube library preparation, adapter hybridization this protocol, process of the hybridization, degraded dna, adapter hybridization, hybridization, p7 adapters for the blunt, dna, tube, p7 adapter
Abstract
This protocol describes the process of the hybridization of P5 and P7 adapters for the Blunt-End-Single-Tube (BEST) library build protocol. Following this protocol produces the P5+P7 adapter complex for use in the BEST library build.

This protocol is based on: Carøe, C., Gopalakrishnan, S., Vinner, L., T. Mak, S. S., S. Sinding, M. H., Samaniego, J. A., Wales, N., Sicheritz-Pontén, T., & P. Gilbert, M. T. (2018). Single-tube library preparation for degraded DNA. Methods in Ecology and Evolution, 9(2), 410-419. https://doi.org/10.1111/2041-210X.12871

Always cite the original paper when using this protocol, in addition to citing this protocols.io protocol.
Protocol materials
Molecular grade H20Merck MilliporeSigma (Sigma-Aldrich)Catalog #W4502
5M NaClInvitrogen - Thermo FisherCatalog #AM9760G
1M Tris-HCl, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
EB bufferQiagenCatalog #19086
0.5M EDTAInvitrogenCatalog #AM9260G
TE Buffer, RNase Free InvitrogenCatalog #AM9858
Before start
  • UV-treat aliquots (ddH2O, etc.) for 10 minutes before use.
  • Mix all the reagents well, before use.
  • Do not UV Eppendorf Tubes/PCR tubes
  • Clean all surfaces with 5% bleach solution followed by 70% ethanol before and after use.
  • Clean all equipment with 70% ethanol before and after use.
Buffer Preparation
Prepare the following reagents:

Adapters (sequences in table below):
  • IS1 (stock: 500μM)
  • IS2 (stock: 500μM)
  • IS3 (stock: 500μM)

Other reagents:
  • Molecular grade H20Merck MilliporeSigma (Sigma-Aldrich)Catalog #W4502
  • 5M NaClInvitrogen - Thermo FisherCatalog #AM9760G
  • 1M Tris-HCl, pH 8.0Invitrogen - Thermo FisherCatalog #15568025 (identical to EB bufferQiagenCatalog #19086 )
  • 0.5M EDTAInvitrogenCatalog #AM9260G
  • TE Buffer, RNase Free InvitrogenCatalog #AM9858

Table 1 Adapter oligo sequences in 5'-3' direction. Sequences sourced from Carøe et al. (2018) Table S1.
OligoSequence
IS15’OMedT*ACACTCTTTCCCTACACGACGCTCTTCCGATCT*A
IS25’OMedT*GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*A
IS3AGATCGGAAGAGC[C3spacer]
*=Phosphothioate linkage
All oligos can be synthesized at Biomers, Germany, HPLC purified, shipped dry, and resuspended in 10 mM Tris-HCl.


Prepare the oligo hybridization buffer (10X)
ReagentVolumeFinal Concentration
5M NaCl 50 μL500 mM
1M Tris-HCl, pH 8.05 μL10 mM
0.5M EDTA1 μL1 mM
ddH2O444 μL/
Total500 μL

Preparation of double stranded adapter
P5 Adapter (in PCR tube)
ReagentVolume
IS1 (500μM)40 μL
IS3 (500μM)40 μL
ddH2O10 μL
Oligo hybridization buffer10 μL
Total100 μL

P7 Adapter (in a different PCR tube to P5)
ReagentVolume
IS2 (500μM)40 μL
IS3 (500μM)40 μL
ddH2O10 μL
Oligo hybridization buffer10 μL
Total100 μL

Vortex both tubes & spin down. Make sure they are well mixed.
Incubate in a thermal cycler with a heated lid (105°C) at 95°C for 10s, then ramp down to 12°C at a rate of 0.1°C per second (see table below).
TemperatureTime
95°C10 sec
Ramp down to 12°C0.1°C per sec
10°CHold


After cooldown, mix the two adapters in a 1.5 mL Eppendorf tube. This is your final stock tube, so label properly with name (e.g. BEST P5+P7 adapter mix), date, and concentration.
This gives a P5+P7 solution of 200 μM.
Dilute with TE buffer to the desired working concentration, e.g., 20 μM, 10 μM, 5 μM, 3 μM, 2 μM.
The working concentration depends on the input DNA amount, which will be specified in the BEST library build protocol.



Protocol references
Carøe, C., Gopalakrishnan, S., Vinner, L., T. Mak, S. S., S. Sinding, M. H., Samaniego, J. A., Wales, N., Sicheritz-Pontén, T., & P. Gilbert, M. T. (2018). Single-tube library preparation for degraded DNA. Methods in Ecology and Evolution, 9(2), 410-419. https://doi.org/10.1111/2041-210X.12871