Feb 09, 2026
Barcoded bead synthesis, array fabrication and sequencing
This protocol is a draft, published without a DOI.
- Vipin Kumar1
- 1The Broad Institute of MIT and Harvard
- BICCN / BICAN
Protocol Citation: Vipin Kumar 2026. Barcoded bead synthesis, array fabrication and sequencing. protocols.io https://protocols.io/view/barcoded-bead-synthesis-array-fabrication-and-sequ-hmp8b45rx
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 21, 2026
Last Modified: February 09, 2026
Protocol Integer ID: 239072
Keywords: barcoded oligonucleotide, oligonucleotides on plrp, barcoded bead, resulting barcoded bead, functionalized bead, beads for downstream application, automated phosphoramidite chemistry, using automated phosphoramidite chemistry, barcode region, barcode regions compatible with slide, photocleavable linker, array fabrication
Abstract
This protocol describes the synthesis of barcoded oligonucleotides on PLRP-S resin using automated phosphoramidite chemistry, followed by deprotection, washing, and storage steps to generate stable, functionalized beads for downstream applications. The resulting barcoded beads are used to fabricate capture arrays and support sequencing workflows through incorporation of photocleavable linkers, capture sequences, and randomized barcode regions compatible with Slide-tags and related platforms.
Materials
PLRP-S resin (1,000 Å, 10 μm), Agilent Technologies (PL1412-4102)
PC linker (10-4920-90), Glen Research
Reverse phosphoramidites (10-0001, 10-9201, 10-0301 and 10-5101-10), Glen Research
0.3 M BMT (BI0166-1005), Sigma-Aldrich)
Sigma-Aldrich reagents: BI0224-0505, B1:B2 1:1; BI0347-0505, BI0349-0505, BI0424-1005, BI0832-2505
Troubleshooting
PLRP-S resin (1,000 Å, 10 μm) was used for barcoded oligonucleotide synthesis.
Loading of the the non-cleavable linker on resin was adjusted to approximately 30 µmol g−1
The Akta OligoPilot 10 oligonucleotide synthesizer was used for synthesis (850 mg scale).
A 0.1 Molarity (M) solution of phosphoramidites was prepared in anhydrous acetonitrile, and 0.3 Molarity (M) BMT was used as an activator for coupling (single coupling, 00:06:00 ).
6m
Two capping steps (before and after oxidation) were performed with the cap A and cap B (Sigma-Aldrich) reagents
For the 6.3 mL column, capping was performed by 1 CV or 1.5 CV for 00:01:00
1m
For the 1.2 mL column, capping was performed by 2 CV for 00:00:30
30s
The oxidation (5 equiv) was performed with 0.05 Molarity (M) iodine in pyridine
The detritylation step was performed using 3% dichloroacetic acid in toluene
Post-Oligonucleotide Synthesis
Protecting groups were removed by incubating the resin in 40% aqueous methylamine for 24:00:00 at room temperature (20 mg resin per 2 mL )
1d
The beads were washed twice with water (1 mL ), three times with methanol (1 mL ), three times with 1:1 acetonitrile:water and three times with acetonitrile (1 mL ).
Finally, the beads were washed three times with 10 millimolar (mM) Tris buffer pH 7.5 containing 0.01% Tween-20
Beads stored in the same buffer at 4 °C
(It was observed that oligos were released in the buffer if the beads were stored for long periods of time.)
To remove the released oligos, beads were washed with 70% acetonitrile/water and resuspended in storage buffer.
Synthesized sequences for the Slide-tags experiments (PC in the sequences denote photocleavable linker) were as follows: (1) incorporation of capture sequence by ligation: the bold bases denote the region that is complementary to the sequence of the 10x gel beads (SLAC beads): 5′-TTT_PC_zCCGGTAATACGACTCACTATAGGGCTACACGACGCTCTTCCGATCTJJJJJJJJTCTTCAGCGTTCCCGAGAJJJJJJJNNNNNNNVVGCTCGGACACATGGGCG-3’, 10x FB1 extension: 5′-GAGCTTTGCTAACGGTCGAGGCTTTAAGGCCGGTCCTAGCAA-3′, splint: 3′-CTGTGTACCCGCCTCGAAACGATTGC-5′; (2) Direct synthesis of capture sequence on beads (TAGS beads): 5′-TTT-PC-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTJJJJJJJJTCTTCAGCGTTCCCGAGAJJJJJJJNNNNNNNVVGCTTTAAGGCCGGTCCTAGCAA-3’; (3) poly(A) beads: 5′-TTT-PC-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTJJJJJJJJTCTTCAGCGTTCCCGAGAJJJJJJJNNNNNNNVVA30.