Apr 13, 2023

Assay for determination of functional concentration of Tn5 transposase

This protocol is a draft, published without a DOI.
Assay for determination of functional concentration of Tn5 transposase
  • Adrian Mcnairn1
  • 1Cornell University
Icon indicating open access to content
QR code linking to this content
Protocol CitationAdrian Mcnairn 2023. Assay for determination of functional concentration of Tn5 transposase. protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 13, 2023
Last Modified: April 18, 2023
Protocol  Integer ID: 80459
Keywords: own tn5 enzyme, functional concentration of tn5, functional concentration of tn5 transposome, amounts of tn5, amount of tn5, tn5 transposome, produced tn5, purified tn5, tn5 transposase, tn5 at that concentration, homemade enzyme preps by qpcr, protein assay, genomic assay, tn5, oligonucleotide concentration, measuring protein concentration, homemade enzyme prep, total protein present, protein concentration, preparations by qpcr, dna oligo, oligonucleotide, cleavage of the plasmid substrate, testing of oligo variation, determination of functional concentration, dna sequences in oligo, plasmids with transposomes insertion, assay
Abstract
Tn5 is used by multiple labs world-wide for its ability to introduce DNA oligos and barcode sequences into libraries and for genomic assays. In many instances, labs produce their own Tn5 enzyme in-house rather than from commercial sources. Our method provides a means of determining the functional concentration of Tn5 in preparations by qPCR to standardize amounts of Tn5 used in assays and identify batch/lot variability. The current standard for assaying in-house produced Tn5 is a plasmid smear. Purified Tn5 is loaded with oligonucleotides and mixed with a plasmid substrate. The plasmid is then run on an agarose gel and checked for smearing, indicating the DNA was cut by the Tn5. The amount of Tn5 is standardized by measuring protein concentration using a protein assay or absorbance at 280nM which provides an approximation based on total protein present, not the functional concentration.This method is modified from Rykalina et al. to evaluate and empirically determine the functional concentration of Tn5 transposomes in homemade enzyme preps by qPCR. The principle is based on decreased Cp(or Cq) values correlating with increased fragmentation caused by the transposome.The change in Cp values functions as a measurement of the activity of the Tn5 at that concentration of oligonucleotide (the greater the number of cycles required to produce a product correlates with the increased cleavage of the plasmid substrate by Tn5) as plasmids with transposomes insertions (cleaved regions) will not amplify. The change in Cp values is then plotted against the oligonucleotide concentration in a line graph and a plateau will appear at the concentration at which the Tn5 is saturated by oligo. The first point in the plateau is the functional concentration.
This method may also be applied to testing the efficiency of changing DNA sequences in oligos used to assemble transposomes as the activity of the transposase is dependent upon the binding sequences contained within the oligo as well as secondary structure formed by the oligo. This property enables testing of oligo variations and barcode efficiencies in our assay. For instance, oligos containing different lengths or different barcodes sequences can be assembled in transposomes and tested in comparison to standard oligos
Materials


HEPES, pH 7.2 (1M)FisherScientificAAJ16924K2
NaCl (5M)InvitrogenAM9760G
EDTA (0.5M)InvitrogenAM9260G
Triton X-100 (10%)VWR97063-864
DTT (1M)Krackeler45-43816-50ML
Glycerol (100%)VWRMK509202
Nuclease-free waterInvitrogenAM9932
Tn5 or TDE1homemade or Illumina    20034197
SDS (10%)Invitrogen             15553027
pUC19NEBN3041S
EcoRINEBR3101S
Zymo Research Clean and Concentrate-5 Zymo                    D4014
LUNA 2x qPCR master mixNEBM3003S
Qubit 1X dsDNA HS Assay KitInvitrogen              Q33231
Equipment:
Eppendorf Thermomixer
qPCR thermocycler
Qubit

Primers:
Transposome
AB
Tn5ME_Rev/5Phos/CTGTCTCTTATACACATCT 
Tn5ME-A (Illumina FC-121-1030)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Tn5ME-B (Illumina FC-121-1031)GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
qPCR primers
ABC
NameSequencepUC19 location(bp)
591bp_pUC19_Tn5_FGCTCACTCAAAGGCGGTAAT748-1319
591bp_pUC19_Tn5_RCTTCAGCAGAGCGCAGATAC
602bp_pUC19_Tn5_FCTTTCACCAGCGTTTCTGGG2396-248
602bp_pUC19_Tn5_RGCTGGCGTAATAGCGAAGAG
610bp_pUC19_Tn5_FCCTATCTCAGCGATCTGTCTATTTC1651-2241
610bp_pUC19_Tn5_RGCGCGGTATTATCCCGTATT

Transposome preparation and assembly
1h 29m
Prepare ME A/Rev or ME-B/rev oligos by annealing equal concentrations of primers.
We typically target 40uM stocks.
 Example: 40uL 100uM Tn5-ME-A +40uL 100uM Tn5-REV +20uL nuclease-free water or 0.1x TE (can be scaled as needed)
Thermocycler program: 95°C for 2min, slow cool to 25deg at 0.1°C/sec, total time ~22 minutes. 00:22:00  

22m
Prepare working stocks of annealed oligos by serial dilution(1:1):  1.25uM, 2.5uM, 5uM, 10uM, 20uM, 40uM
Prepare Tn5 transposomes by combining 9uL of the Tn5 to be tested with 1uL annealed oligos (equates to final concentration of: 0.125uM,0.25uM, 0.5uM, 1uM, 2uM, 4uM)
a.  If the estimated concentration of Tn5 is high, prepare serial dilutions first in Tn5 exchange buffer
b.  Volumes may be titrated down if Tn5 to be tested is in limited quantities(i.e 0.5uL oligo in 4.5uL Tn5) 
   

ABCDEFG
Oligo Concentration(uM)1.252.55102040
Oligo(uL)111111
Tn5(uL)999999
Final vol101010101010
Final Conc.(uM) 0.1250.250.5124
 Incubate for 21 hours at 25°C w/shaking(600rpm) on Eppendorf Thermomixer Overnight 21 h
Shorter incubations (1 hour) are possible, but we find the longer incubations provides better, more consistent, results.
Template preparation
1h 29m
01:00:00 Digest pUC19 with EcoRI to generate a linear template. 
a. Column purify the plasmid DNA and adjust concentration to 25ng/uL
b. The digest reaction may be scaled to provide a stock of linearized plasmid for future use
1h
Tagmentation
1h 29m
In duplicate, prepare tagmentation master mix and test each concentration of transposome on 25ng linearized pUC19
a.  Include a no Tn5 control for reference (0uM)
b.  For no Tn5 control, increase water to 11.5uL/reaction
c. 10X Tango restriction enzyme buffer (ThermoFisher) or 10X Cutsmart buffer(NEB) are used to provide the magnesium Tn5 requires for tagmentation. A recipe for an alternative 2X buffer is listed below.
AB
StockVol per 25uL rxn (uL)
10X Tango RE Buffer2.5
Nuclease-free water18
DMF2.5
Linearized pUC19(25ng/uL)1
Tn51
Tagmentation Master Mix
2X Tagmentation Buffer
StockVol for 10mLFinal Conc. Supplier
1M Tris-HCl pH7-8200uL20mMInvitrogen #AM9850G, #AM9855G
1M MgCl2100uL10mMInvitrogen #AM9530G
Nuclease-free water9.7mL Invitrogen AM9932
Incubate at 37°C for 1hr at 600rpm
Stop the reaction by adding 1uL of 2%SDS to each reaction(final conc. 0.08%)
a.    55°C for 7 minutes to remove transposomes00:07:00

7m
Quench SDS by adding 3ul 10% Triton X-100 to reactions
Final volume should be 29uL
Qubit or nanodrop DNA for normalization (~0.86ng/uL)
a.    Quantifying the DNA first enables the assay to be more quantitative
qPCR
1h 29m
Dilute transposed DNA 1:10 in nuclease free water for qPCR
a.   using too much DNA may lead to difficulty in determining Cp and lead to higher data variability
b.   Controls: linearized pUC19 without Tn5 and a NTC control
Setup qPCR reactions using primer pairs (recommend running at least 2 pairs)
a.    Pairs 591, 602, and 610 may be run on the same program

Run qPCR using following settings:
a.    95°C for 1 min, followed by 35(minimum) to 45 cycles of 95°C for 15 sec, 60°C for 20 sec, 72°C for 30sec, then a melt curve
Two-step protocols may also be used alternating 95°C for 15 sec, 60°C for 20 sec
Analyze and graph delta Cp versus concentration. 
a. The no Tn5 control provides the reference value as the plasmid should be intact (i.e Subtract the Geomean of the no Tn5 replicates from the Cp of the test samples).
b. The higher the delta Cp, the more cleavage of the plasmid, indicating higher Tn5 tagmentation activity
c. The concentration at which the graph plateaus or peaks at, is the functional concentration of the Tn5 prep

Data Analysis Example
Primer pair:610
SampleCpAve Cpdelta Cp
0.58.898.788.988.880.74
0.59.128.818.978.970.83
19.749.89.749.761.62
19.679.999.799.821.68
2.211.3611.3411.4911.403.26
2.211.3711.6711.5711.543.40
3.512.5212.6312.7312.634.49
3.512.712.7412.8612.774.63
59.839.949.929.901.76
59.7910.059.979.941.80
noTn58.28.028.188.13-0.01
noTn58.257.978.218.140.00
NTC24.0423.9223.923.9515.81
NTC24.2724.2524.2624.2616.12
Example results from qPCR testing of a Tn5 prep
Primer pair:610
Conc.(uM)ave delta CPstdev
0.5uM0.790.06
1uM1.650.04
2.2uM3.330.10
3.5uM4.560.10
5uM1.780.03


Protocol references
Rykalina, V., Shadrin, A., Lehrach, H. & Borodina, T. qPCR-based characterization of DNA fragmentation efficiency of Tn5 transposomes.Biol. Methods Protoc.2, bpx001 (2017).