Mar 20, 2026
Analysis of gene expression using RT-qPCR in blood stage plasmodium falciparum
- Emma Kals1
- 1University of Cambridge
Protocol Citation: Emma Kals 2026. Analysis of gene expression using RT-qPCR in blood stage plasmodium falciparum . protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7peo9gwz/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 10, 2024
Last Modified: March 20, 2026
Protocol Integer ID: 95007
Keywords: blood stage plasmodium, plasmodium, pfrh family of protein, qpcr of invasion gene, expression of the invasion gene, pfrh protein, analysis of gene expression, essential invasion gene, gene expression, housekeeping genes pfactin, invasion gene, qpcr assay, expression of the pfeba, expression peaking in late schizont, pfeba, pfama1, pfrh family
Funders Acknowledgements:
Welcome
Grant ID: 222323/Z/21/Z
Abstract
The protocol here was designed to compare the gene expression using RT-qPCR of invasion genes in Plasmodium falciparum knock-out lines. The samples were blood stage. The aim was to monitor the expression of the PfEBA and PfRH family of proteins, as well as two essential invasion genes, PfAMA1 and PfRH5 and the housekeeping genes PfActin I to act as controls. PfEBA and PfRH proteins have highly stage-dependent expression, with expression peaking in late schizonts (~44-48h) and merozoites. Therefore, to ensure all samples were at the same stage, we tightly synchronised schizonts
and then treated them with compound 2 (C2), which pauses the schizonts ~15mins before egress. We assessed whether the C2 treatment had any transcriptional impact by measuring the expression of the invasion genes in wild-type NF54 before and after 3.5 hours of C2 treatment; no differences were observed. The protocol does not describe how to optimise the qPCR assay; this is essential and was done in order to determine the conditions described here.
Troubleshooting
Info
The below protocol was designed to look at the expression of invasion genes that are expressed late in the devleopmental cycle of the blood stage (schizonts). Therefore, samples are prepared from compound 2 treated schizonts. We collected samples for all the lines in parallel over 4 weeks in different blood each week, collecting one sample a week with two invasion cycles in between.
Sample preparation - Tight Synchronisation
Tuesday - tight synchronisation steps
All the lines were synchronised in parallel using a 150 ml culture at a 1% HCT.
Prepare - Per sample, make two tubes with 5 ml of percol, one in a 15 ml tube, and place in the 37 oC water bath. Place media into the 37 oC water bath. Per vented flask - add 35 ml media and 3 ml of 50% HCT and warm to 37 oC.
9.00am - Smear parasites and check culture is mainly late schizont and a few rings as means culture has started to egress.
Use the aspirator to remove all but 5 ml of media from the flask
Resuspend blood in media and then use a 5ml strippet with the pipette boy set to slow
carefully layer the culture over the percol in 15ml tube.
Centifuge at 2600 rpm, 11 min, break 1, acceleration 3
Take off the late stages and put back into the flask with media and blood (no need to wash, flask should contain 35 ml media and 3 ml blood at 50% HCT). Place the flask in a gassed incubator for 3.5 h at 37 oC. Put RPMI, media and sorbitol in the 37 oC water bath.
After the 3.5 h incubation time aspirate off all but 5 ml of the media if the sample sedimented (if not then pellet by centrifugation with standard parasite spin). Resuspend RBCs in media and layer over percol in 5 ml tube.
Spin 2600 rpm, in new centrifuge, 11 min, break 1, acceleration 3
Discard supernatant (including any remaining late-stage infected RBCs). Resuspend the pellet (containing newly invaded rings) in 5 ml of sorbitol and transfer to a 50 ml tube. Place in the 37 oC water bath for 5 min
Pellet by centrifuging with standard parasite spin. Discard supernatant and resuspend in 20 ml of warm RPMI.
Pellet by centrifuging with standard parasite spin. Discard supernatant, suspend pellet in media from the flask, gas flasks. Leave at room temperature till 7pm then place in 37 oC incubator
Wednesday - Leave at 37 oC
Thursday - Repeat the synchronisation steps from Tuesday . At the end of the day, leave the flask at room temperature overnight until 7 pm on Friday, then place it back at 37 oC. This ensures that the parasites will egress Tuesday morning allowing the steps to be repeated on the same day every week.
Sample preparation - sample collection - Schizont isolation, Compound 2 treatment and saponin lysis
When the parasitemia is high (this can take two weeks of synchronisation), on the Thursday cycle, let approximately one third of the culture reinvade and then treat two-thirds with compound 2.
Isolate the late stages using 5 ml of percol in a 15 ml tube, as decribed above. Take off the late-stage band and add it to a 15 ml tube, add 5 ml warm RPMI
Resuspend pellet in 40 ml media in a vented 250 ml culture flask. Add the PKG inhibitor Compound 2
((4-[7-[(dimethylamino)methyl]-2-(4-fluorophenyl)imidazo[1,2-α]pyridine-3-yl]pyr- imidin-2-amine)) at 1 µM. Compound 2 arrests schizonts ~15min prior to egress, ensuring the samples were all comparable in developmental stage.
Incubate at 37 oC in a gassed incubator for 3.5 h.
Towards the end of the incubation time, set up for the next step: Warm to 37 oC: 50 ml falcon tube; get ready - 1xPBS/0.1% saponin (1% saponin stock in freezer, dilute 1ml into 9ml of PBS), PBS and 1.5 ml microcentrifuge tube. Put 0.1% saponin and PBS on ice.
Spin to pellet, remove supernatant (careful not to disturb pellet) and resuspend in 1ml 1xPBS/0.1% saponin. Leave on ice for 10 min.
Pellet the cultures at 1100 rpm for 5 min in 50 ml falcon tube.
Wash in 5 ml of ice-cold PBS, centrifuge and remove supernatant.
Resuspend in 1 ml 0.1% saponin ice chilled, transfer to 1.5 ml Eppendorf tube and leave on ice for 10 min.
Spin to pellet. The supernatant should no longer be red (repeat wash step if it is). Remove supernatant, and flick pellet so nothing is stuck to the tube, resuspend in 200 ul of PBS and split over two tubes.
Add 1000ul of TriZol to each tube in the fume hood. Mix well and place at 37oC for 5mins. Then place on ice if RNA extraction is being done right away or at -80oC.
RNA isolation and DNase I treatment
Reagents - Invitogen Thermo Fisher scientific Phasemaker tubes Ref A33248. Zymo research RNA Clean and concentrator - 5 (Cat No R1015).
For each sample, thaw one tube. (For each, there are two tubes containing 100 ul of sample in PBS and 900 ul of Trizol) Only perpare one tube per sample at a time in case of issues or low yeild the second tube can be prepared.
If you can see clumps of sample add more Trizol and heat at 37 oC for 5 mins to ensure everything is dissolved.
Spin one phasemaker tubes per tube of sample at 12,000 g for 30 s
Add 1ml of sample in trizol to each phasemaker tube and incubate at room temperature for 5 min
Add 200 ul chloroform per tube and shake vigorously for 15 s.
Incubate for 3 min at RT then centrifuge at 12,000 g for 5mins at 4 °C
Remove top aqueous phase to a new tube
Use Zymo Clean and Concentrator -5 kit (spin columns) to extract RNA by adding equal volume of ethanol to aqueous phase and loading onto zymo column
Proceed according to the manufacturer’s RNA clean-up protocol , including on-column DNase I treatment and elute in 15 ul RNase free water per column.
Add an equal amount of ethanol and mix – 450 ul. Then transfer to a spin column. (Zymo Clean and
Concentrator -5 kit). Spin and discard flow through. Follow protocol in kit instuctuions (from step 3 pg 5). All spins at room temperature at 14,000 g/rcf, for 30 s.
Add 400 ul of wash buffer, spin and discard flow through.
For each column mix 5 ul of DNase I (stored in aliquots in freezer) with 35 ul of DNA Digestion Buffer. Add to the column and leave at room temperature for 15 min.
Add 400 ul of RNA prep buffer, spin and discard flow through.
Add 700 ul of RNA wash buffer, spin and discard flow through.
Add 400 ul of RNA wash buffer, spin and discard flow though
Transfer the column to a clean tube and spin for 60 s. This helps remove any residue of the wash buffer improving the purity of the RNA
Transfer the column to a clean labelled tube. Add 20 ul of RNase free water to the column to elute, leave for 5mins to allow the column to rehydrate. Then spin.
Quantify the RNA in each sample using a NanoDrop. The A260/A280 ratio should be close to 2 (1.8 is acceptable). Most samples prepared with the above protocol were in the target range. Further clean-up is needed if the ratio is below 1.7, such as via ethanol precipitation but this will cause loss of RNA.
cDNA synthesis and second DNase treatment
Using the superscript IV VILO MM with ezDNase enzyme (ThermoFisher 11756050) following the manufacturer’s instructions alongside a no reverse transcription (RT) control.
I used 1ug of RNA per sample. Set up the ezDNase with 2 ug (1 ug per RT and NO RT) in PCR strips, leaving empty tubes in between for RT step. 37 oC 2 min.
Add 10x Buffer 2 ul, ezDNase enzyme 2 ul, DNA (2ug up to 16ul) and water to make total 20ul.
Transfer 10 ul of each sample to a new tube. Add 4 ul of MM and 6 ul of water to each sample. Add the RT MM to one tube and the No RT MM to the other tube.
Place tubes into a thermocycler: 25 oC for 10 min, 50 oC for 10 min and 85 oC for 5min.
Store at -20 oC - cDNA is stable long term at -20 oC degrees and can be stored for days-weeks at 4 degrees.
RT-qPCR
Using SYBR Power SYBR Green PCR Master Mix (Fisher scientific 4367659). Use primers at 500-800 nM per reaction (I use at 650 nM).
Note
It is crucial to optimise the exact assay conditions before running. This includes the annealing temperature, checking no-RT controls are lower than RT samples, the reaction efficiency with a concentration gradient, etc. Details of how to do this can be found in standard qPCR optimisation guides.
Use 1-10 ng cDNA per reaction (assuming a 100% conversion from RNA, cDNA cannot be quantified due the presence of residual primers and dNTPs, I use 10ng cDNA per reaction). Dilute cDNA to desired concentration (e.g. 10 ng/ul).
Swirl to mix Power Up Master mix. Vortex primers to mix > Centrifuge briefly
For a reaction volume of 10 ul per well, 5 ul Power up Master mix, 0.65 ul Primers, 1 ul of cDNA (10 ng), Nuclease-free water up to 10 uL. Prepare Master Mixes for each set of primers and mix well. Aliquot 9 ul of Master Mix to each well of 384-well qPCR plate. Add 1 ul cDNA template to each well, or not to no-template control wells.
Details of plate set up.
For each sample run both a RT and no no-RT control for each gene – the No-RT is to control for DNA contamination (there should be very low amplification from No-RT wells).
Run a set of concentration standards made from of genomic DNA for each primer set run on the plate. The same standards should be used for all experiments.The concentrations used were (10, 2, 0.4 and 0.08 ng/µl).
I ran a minimum of triplicate wells for the samples and the standards, then one for the no-RT control and water controls.
Seal plate with plastic cover > Spin down again
Cycling conditions; 95 oC for 10 min, followed by 40 cycles of 95 oC for 15 s, 55 oC for 20 s, 60 oC
for 60 s. Then run a melt curve of 65 oC for 5 s up to 95 oC.– These are standard conditions but will change depending on the size of your amplicon and Tm of your primers. We used a Bio-rad 384 well RT PCR machine (CFX384). The melt curve is to determine if there is any non-specific amplification.
I pipetted the samples into the 384-well plates using an Opentrons OT2 pipetting robot with an Opentrons Gen 2 p20 pipette to minimise technical variation, keeping the 384-well plate cooled to 10 degrees. Each set of samples was run over two plates, with all lines on each plate and primers for 7 genes with Actin I (housekeeping reference) repeated on both plates.
Analysis
Analysis was done using a custom Python script. Any outliers were eliminated by removing any points of the triplicate repeat that were more than 0.3 Cq away from the mean of the data points. For each set of primers, a linear fit was used to the measurements of the standards. The Cq values were interpolated based on the standard curve. Visually confirm that there was a good separation between the RT samples and the no-RT control. Each gene’s expression levels were then normalised to the housekeeping gene Actin I in the given sample. The gene expression of each knock-out line is expressed as a relative fold change compared to the wild-type. To determine which changes were significant, a one-sample t-test was performed with the null hypothesis that the true mean of the population equals 1 at a 95% level of significance, which would represent no change in gene expression relative to the corresponding reference line.
Citation
LINK
Citation
LINK
Citation
LINK
Citation
LINK
Details of the primers used
| A | B | C | D | E | F | G | H | I | |
| Proteins | Gene ID | F primer | R Primer | Forward | Reverse | Source | Length | Relationship to KO | |
| PfActin1 | PF3D7_1246200 | P0150_qPCR_F_Actin | P0151_qPCR_R_Actin | TGCACCACCAGAGAGAAAAT | ACTTGGTCCTGATTCATCGT | (Stubbs, et al. 2005) | 115bp | NA | |
| PfAMA1 | PF3D7_1133400 | P0138_qPCR_F_AMA1 | P0139_qPCR_R_AMA1 | GGATTATGGGTCGATGGAAATTGTG | CATAATCTGTTAAATGTTGTTCATATTGTTTAGGTTGAT | (Nery, et al. 2006) | 145bp | NA | |
| PfEBA175 | PF3D7_0731500 | P0142_qPCRF_EBA175 | P0143_qPCR_EBA175 | AATTTCTGTAAAATATTGTGACCATATG | GATACTGCACAACACAGATTTCTTG | (Blair, et al. 2002) | 96bp | After | |
| PfEBA140 | PF3D7_1301600 | P0140_qPCRF_EBA140 | P0141_qPCRR_EBA140 | GCAAAATAAATGCAACAATGAATA | AACAAGGACCCGGTGAACTA | (Blair, et al. 2002) (Stubbs, et al. 2005) | 80bp | After | |
| PfEBA181 | PF3D7_0102500 | P0146_qPCRF_EBA181 | P0147_qPCRR_EBA181 | GCGGGTAGTACAATATTAGATGATTC | TGTTGTGTGCTAAAATTATGTTCTTG | (Blair, et al. 2002) | 107bp | After | |
| PfEBA165 | PF3D7_0424300 | P0154_qPCRF_EBA165 | P0155_qPCRR_EBA165 | ATTAAATCGTACATCACATACGCA | ACGCCCATCATGCACATT | (Blair, et al. 2002)(Stubbs, et al. 2005) | 100bp | After | |
| PfRH1 | PF3D7_0402300 | P0124_qPCR2_F_RH1 | P0125_qPCR2_R_RH1 | GATAAAGAGCAAGAAAAACAACAAC | CATTACCTCTTCTTGATTTCTACCA | (Stubbs, et al. 2005) | 105bp | After | |
| PfRH4 | PF3D7_0424200 | P0134_qPCR_F_RH4 | P0135_qPCR_R_RH4 | GAAATGACGCAATTCCCTCAAAAGA | GGTGTGTTTTATTTATATCATGTTGATTCTGTGA | (Nery, et al. 2006) | 93bp | Before | |
| PfRH2a | PF3D7_1335400 | P0128_qPCR2_F_Rh2a | P0129_qPCR2_R_Rh2a | ATTAAACCTACAAAGCATGGTGATA | GATCTGTTCCTGATCTTTTAGTTGA | (Stubbs, et al. 2005) | 124bp | After | |
| PfRH2b | PF3D7_1335300 | P0132_qPCR2_Rh2b_F | P0133_qPCR2_R_Rh2b | TGACACTGATGAAAATGCTGA | TGTCCTTCTTTATTTCCCCC | (Stubbs, et al. 2005) | 129bp | After | |
| PfRH3 | PF3D7_1252400 | P0152_qPCR_F_RH3 | P0153_qPCR_R_Rh3 | CACGAAAAATTCGAATAATGG | CCAATAGCAAATCCTGAAGC | (Stubbs, et al. 2005) | 105bp | After | |
| PfRH5 | PF3D7_0424100 | P0118_qPCR_F_Rh5 | P0119_qPCR_R_RH5 | ACGAAGAATCAAGAAAATAATCTGACGTTACT | TGTTGAATGATCTTTAGCATTATTTGTTTTTATATTCTCTTT | (Gomez-Escobar, et al. 2010) | 150bp | NA |
List of primers used in qPCR. F - forward, R - reverse. Ref - reference sequence originally published in. Length - Length of PCR
Citations
Step 33
Gomez‐Escobar N, Amambua‐Ngwa A, Walther M, Okebe J, Ebonyi A, Conway DJ.. Erythrocyte Invasion and Merozoite Ligand Gene Expression in Severe and Mild Plasmodium falciparum Malaria.
doi/10.1086/649902Step 33
Stubbs J, Simpson KM, Triglia T, Plouffe D, Tonkin CJ, Duraisingh MT, et al. . Molecular Mechanism for Switching of P. falciparum Invasion Pathways into Human Erythrocytes.
doi/10.1126/science.1115257Step 33
Nery S, Deans AM, Mosobo M, Marsh K, Rowe JA, Conway DJ. . Expression of Plasmodium falciparum genes involved in erythrocyte invasion varies among isolates cultured directly from patients.
doi.org/10.1016/j.molbiopara.2006.05.014Step 33
Blair PL. . Transcripts of developmentally regulated Plasmodium falciparum genes quantified by real-time RT-PCR.
doi/10.1093/nar/30.10.2224