Apr 05, 2024

An NGS amplicon tiling protocol for HIV-1 drug resistance detection using Illumina® COVIDSeq™ Assay Kit V.3

An NGS amplicon tiling protocol for HIV-1 drug resistance detection using Illumina® COVIDSeq™ Assay Kit
  • 1Association of Public Health Laboratories;
  • 2Oregon State Public Health Laboratory
Icon indicating open access to content
QR code linking to this content
Protocol CitationNoah C. Hull, Eugene Yeboah, Laura Tsaknaridis, Vanda Makris 2024. An NGS amplicon tiling protocol for HIV-1 drug resistance detection using Illumina® COVIDSeq™ Assay Kit. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ldmq4ol5b/v3Version created by Eugene Yeboah
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 31, 2024
Last Modified: April 05, 2024
Protocol Integer ID: 94428
Keywords: hiv genome, hiv drug resistance mutation, immunodeficiency virus drug resistance, hiv drug resistance testing, hiv complete genome, hivseq, performance of the illumina covidseqtm assay, use of the illumina covidseqtm assay, illumina covidseqtm assay, viral replication of hiv, human immunodeficiency virus, hiv-pc-1000-1, hiv-pc-100-1, hiv-pc-100000-1, stanford hiv drug, hiv-pc-1000000-1, such as the illumina covidseqtm assay, hiv-pc-1000-2, hiv-pc-1000-3, hiv-pc-10000-3, hiv-pc-10000-2, hiv-pc-100-2, hiv-pc-100-3, hiv, hiv-pc-1000000-3, hiv-pc-100000-3, hiv-pc-100000-2, hiv-pc-1000000-2, hiv-pc-10-1, recommendations of the international antiviral society, hiv-pc-10-3, hiv-pc-10-2, covidseqtm assay, illumina covidseq, accurate information for drug resistance detection, international antiviral society, drug resistance mutation, library preparation of the diluted viral nucleic extract, samples at the different viral load, illumina covidseq ruo kits reference guide, covidseq assay, viral copy number dilution, drug
Abstract
Summary
Human immunodeficiency virus (HIV) is the pathogen responsible for acquired immunodeficiency syndrome (AIDS) and continues to be a significant global public health issue. HIV can be managed with antiretroviral (ART) drug treatments by suppressing the viral replication of HIV within the infected individual. Unfortunately, due to the nature of the virus, drug resistance can occur, making the ART drug no longer effective. An amplicon-based assay, such as the Illumina COVIDSeqTM Assay (RUO), was adopted to sequence the entire genome of the HIV-1 virus. We modified the Illumina COVIDSeqTM Assay (RUO) protocol to prepare HIV-1 libraries and sequenced on the Illumina MiSeq. The sequencing data was analyzed by Terra.bio and Exatype NGS. This study demonstrated the utility of the assay to efficiently sequence near-complete genome of HIV-1 virus up to 488 viral copies and provide accurate information for drug resistance detection.    
Background

According to the World Health Organization, an estimated 39.0 million [33.1–45.7 million] people live with HIV at the end of 2022 [1]. UNAIDS reported that 40.4 million [32.9 million–51.3 million] people have died from AIDS-related illnesses since the start of the epidemic [2]. HIV drug resistance testing is crucial for managing and preventing ARV failures for persons undergoing treatment or drug-naive individuals [3]. Traditionally, HIV drug resistance testing is performed by Sanger sequencing of specific regions within the HIV genome to identify drug resistance mutations. Next-generation sequencing (NGS) technologies have recently been implemented to improve sensitivity and reproducibility and reduce the cost per sample by multiplexing.
In this study, the Oregon State Public Health Laboratory (OSPHL), in collaboration with the Association of Public Health Laboratory (APHL), evaluated the performance of the Illumina COVIDSeqTM Assay (RUO) for HIV complete genome sequencing (HIVSeq). We describe a step-by-step HIV-1 virus genome sequencing protocol that leverages the Illumina COVIDSeqTM Assay (RUO), with reagents remaining the same.  The modified protocol utilizes HIV-1 primers designed through primal scheme. We demonstrate that whole genome sequencing of the HIV-1 virus can be achieved with extensive sequencing coverage for viral copies up to 488. Thereby expanding the use of the Illumina COVIDSeqTM Assay (RUO) beyond SARS-CoV-2.
Results
To evaluate the performance of the assay, HIV-1 strain: IIIB positive culture control from ZeptoMetrix (Part #v0801032CF) was extracted and serially diluted to the following concentration: 10ᶺ(-1), 10ᶺ(-2), 10ᶺ(-3), 10ᶺ(-4), 10ᶺ(-5), and 10ᶺ(-6). Library preparation of the diluted viral nucleic extracts was sequenced on the Illumina MiSeq 2 x 150 bp. Viral copies ranged from 48.8 to 4,880,000 viral RNA copies/ul. We evaluated the assay's performance for accuracy, precision, sensitivity, specificity, and limit of detection.
HIV-1 primers designed with Primal Scheme: Complete Primers under MATERIALS section.
To verify the coverage and detect drug-resistant mutations of all samples, we used FASTQ files exported from the MiSeq instrument. We uploaded them to the Terra platform, used the Illumina PE TheiaCov workflow developed by Theiagen, and mapped them to reference NC-001802.1 to generate run and quality metrics. FASTA files were analyzed for drug resistance mutations using Exatype NGS by Hyraxbio.  All samples were run in triplicates. Quality metrics and coverage analysis are shown in Tables 1A and 1B. The average percent reference coverage for viral loads of 4,880,000, 488,000, 48,800, 4,880, and 488 were >90%. Reference coverage for negative controls was undetected due to assembly failure. These results showed that the assay performed well in sequencing HIV-1-positive virus.
To evaluate the accuracy of the assay, we leveraged the HIV-1 positive control’s mutations. The positive control has a non-polymorphic mutation F227L found in the non-nucleoside reverse transcription. We calculated the percent accuracy based on the ability of the assay to identify this mutation in all 17 samples that passed quality control metrics. Table 2 shows a 100% consistent detection of the F227L mutation in all samples.
We evaluated the analytical sensitivity of the assay based on the HIV-1 positive control drug-resistant profile within the NRTI – Nucleoside Reverse Transcriptase Inhibitors (susceptible), NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors (3 intermediate and F227L mutation), PI - Protease Inhibitors (susceptible), and INSTI - Integrase Inhibitors regions (susceptible). The assay detected concordant results in 64 out of 68 drug classes and their resistance calls in all the dilution series (64/68) x 100 = 94%). Data is shown in table 4. Within-run precision was calculated based on three replicates from each dilution series (4.880,000, 488,000, 48,000, 4,800, 480, and 48.8 copies) of the HIV-1 subtype B positive control and three replicates of a negative template control. There were expected 17 positive and eight negative (3 negative and five non-HIV specimens). The miscalculation rate was 0%. Also, Positive Predictive Value =100% and Negative Predictive Value = 100%. Figure 1 demonstrates that sequencing the HIV-1 genome using the COVIDSeqTM Assay (RUO) (on the Illumina MiSeq 2X150) produces >80% coverage of the complete HIV-1 genome with viral copy down to 488 copies/ul. 
Analytical specificity and coinfection for HIV-1 genome were evaluated using confirmed positive samples of HAV-Hepatitis A, HBV-Hepatitis B, HCV-Hepatitis C, and two TP-Syphilis. All samples were confirmed to be negative for HIV-1. QC metrics failed for all five samples due to genome assembly failure and no reads, as depicted in Table 6.  Another evaluation of analytical specificity of the mutation detected was calculated based on the assay’s ability to detect the mutation, F227C, a rare nonpolymorphic mutation at position 106, at NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors region in each of the 17 samples at the different viral loads of (4.880,000, 488,000, 48,000, 4,800, 480, and 48.8). Table 5 shows (17/17) x 100 =100.00% analytical specificity to detect the mutation.
We evaluated the Limit of Detection by analyzing all samples, their experimental/expected results, and the ability to detect mutations and drug-resistant calls in all four drug-resistant regions of the Pol Region (NRTI, NNRTI, PI, and INSTI). Table 6 shows a 100% concordance between expected and experimental results for viral copy number dilutions up to 10ᶺ (-5) or 488 copies.
At 10ᶺ (-6) or 49 viral copies, sensitivity decreases to 8/12 = 67%.

These results in Table 7 indicate that positive HIV-1 samples with viral loads up to 488 copies can reliably produce a drug resistance profile. Viral copies under 488 have inconsistent results and do not pass quality control metrics.



*One sample from HIV_PC_1:10e4 (2) failed QC due to sample loss during library preparation.  Analysis shows inclusion and omission metrics. Triplicate Average: Average mean calculation for dilutions (all dilutions were run in triplicate)


Table 1B. HIV-1 Positive Control Quality Control Metrics (Raw Data) Analysis on Terra.bio
ABCDEF
Dilution Factor Assembly Length Unambiguous Assembly Mean Coverage Number of  Ns Total Number % Reference Coverage
HIV_PC_10_1 9040 6854.19 128 9175 98.46
HIV_PC_10_2 9040 5455.84 135 9182 98.46
HIV_PC_10_3 9079 11842.6 88 9174 98.89
HIV_PC_100_1 9040 6085.74 125 9172 98.46
HIV_PC_100_2 9041 6447.61 122 9169 98.48
HIV_PC_100_3 9040 4327.41 102 9149 98.46
HIV_PC_1000_1 9041 10369.2 105 9152 98.48
HIV_PC_1000_2 9040 4998.39 121 9168 98.46
HIV_PC_1000_3 9039 3504.9 105 9152 98.45
HIV_PC_10000_1 9044 14738.5 127 9174 98.51
HIV_PC_10000_2 5010 8504.21 3419 8432 54.57
HIV_PC_10000_3 8769 4044.16 375 9151 95.51
HIV_PC_100000_1 8739 5186.66 399 9142 95.19
HIV_PC_100000_2 8730 5353.17 411 9156 95.09
HIV_PC_100000_3 8129 3741.45 1014 9149 88.54
HIV_PC_1000000_1 6263 2370.05 2879 9147 68.22
HIV_PC_1000000_2 6784 2204.5 2361 9151 73.89
HIV_PC_1000000_3 6441 2068.95 2713 9156 70.16
*One sample from HIV_PC_1:10e4 [HIV_PC_10000_2] failed QC due to sample loss during library preparation.
Table 3. HIV Drug Resistance Mutations

HIV-1 drug-resistant profiles from Exatype NGS, using the Stanford HIV drug-resistant database.

ABCDE
Dilution Factor NRTI – Nucleoside Reverse Transcriptase Inhibitors NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors PI - Protease Inhibitors INSTI - Integrase Inhibitors
HIV_PC_10_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10_2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10_3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100_2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100_3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_1000_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_1000_2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_1000_3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10000_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10000_2 Low coverage Low coverage Low coverage Low coverage
HIV_PC_10000_3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100000_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100000_2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_100000_3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_1000000_1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Low coverage
HIV_PC_1000000_2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Low coverage Low coverage
HIV_PC_1000000_3 Susceptible 2-Susceptible, 3-Low coverage ETR : [RT] F227L Susceptible Low coverage
*One sample from HIV_PC_1:10e4 [HIV_PC_10000_2] failed QC due to sample loss during library preparation.
Table 4: Within Run Precision
ABCDEF
Sensitivity Number of Copies n=6/dilution NRTI – Nucleoside Reverse Transcriptase Inhibitors NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors PI - Protease Inhibitors INSTI - Integrase Inhibitors
8/12 HIV_PC_10ᶺ(-6), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Low coverage
HIV_PC_10ᶺ(-6), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Low coverage Low coverage Low coverage
HIV_PC_10ᶺ(-6), _3 Susceptible 2-Susceptible, 3-Low coverage ETR : [RT] F227L Susceptible Low coverage Low coverage
12/12 HIV_PC_10ᶺ(-5), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10ᶺ(-5), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
HIV_PC_10ᶺ(-5), _3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
*8/12 8/8 HIV_PC_10ᶺ(-4), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10ᶺ(-4), _2 Low coverage Low coverage Low coverage Low coverage Susceptible
HIV_PC_10ᶺ(-4), _3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
12/12 HIV_PC_10ᶺ(-3), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10ᶺ(-3), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
HIV_PC_10ᶺ(-3), _3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
12/12 HIV_PC_10ᶺ(-2), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10ᶺ(-2), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
HIV_PC_10ᶺ(-2), _3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
12/12 HIV_PC_10ᶺ(-1), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible
HIV_PC_10ᶺ(-1), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
HIV_PC_10ᶺ(-1), _3 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Susceptible Susceptible
(64/68) x 100 = 94% *(64/72) x 100 = 89% *One sample from HIV_PC_1:10e4 [HIV_PC_10000_2] failed QC due to sample loss during library preparation.

Table 5: Analytical Specificity for Mutation Detected:
ABC
Analytical Specificity Number of Copies n=6/dilution NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors
3/3 HIV_PC_10ᶺ(-6) ETR : [RT] F227L
3/3 HIV_PC_10ᶺ(-5) ETR : [RT] F227L
*2/3 2/2 HIV_PC_10ᶺ(-4) ETR : [RT] F227L
Low coverage
ETR : [RT] F227L
3/3 HIV_PC_10ᶺ(-3) ETR : [RT] F227L
3/3 HIV_PC_10ᶺ(-2) ETR : [RT] F227L
3/3 HIV_PC_10ᶺ(-1) ETR : [RT] F227L
(17/17) x 100 =100.00%
*(17/18) x 100 = 94%
*One sample from HIV_PC_1:10e4 (2) failed QC due to sample loss during library preparation.  Analysis shows inclusion and omission metrics.
Table 6: Analytical Specificity of Co-infection
ABC
Accession # Specimen HIV-1 Assay Result
7427 HAV+ No sequence
1701 HBV+ No sequence
1740 HCV+ No sequence
4023 TP+ No sequence
7214 TP+ No sequence
Table 7: Limit of Detection Threshold
ABCDEF
Sensitivity Number of Copies n=6/dilution NRTI – Nucleoside Reverse Transcriptase Inhibitors NNRTI - Non-Nucleoside Reverse Transcriptase Inhibitors PI - Protease Inhibitors INSTI - Integrase Inhibitors
8/12 HIV_PC_10ᶺ(-6), _1 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Susceptible Low coverage
HIV_PC_10ᶺ(-6), _2 Susceptible 2-Susceptible, 3-Intermediate ETR : [RT] F227L Low coverage Low coverage Low coverage
HIV_PC_10ᶺ(-6), _3 Susceptible 2-Susceptible, 3-Low coverage ETR : [RT] F227L Susceptible Low coverage Low coverage
At 10ᶺ (-6) or 49 viral copies, sensitivity decreases to 8/12 = 67%. These results indicate that positive HIV-1 samples with viral loads up to 488 copies can reliably produce a drug resistance profile. However, viral copies under 488 have inconsistent results and do not pass quality control metrics.
Note: It is important to note that the positive control was a culture of a USA HIV-1 strain IIIB, and primers used for this assay were designed based on HIV-1 sequences primarily from North America. Due to the high genome variability of the HIV-1 virus, primers must be designed using sequences in or around the region of interest. The primers used in this assay performed well, with good genome coverage on samples from North America. However, they showed poor coverage of HIV-1-positive samples from different continents. Hence, the recommendation of designing primers specific to the region to account for variations within the region to achieve higher genome coverage. References: [1]“HIV and AIDS.” World Health Organization, World Health Organization, 13 July 2023, www.who.int/news-room/fact sheets/detail/hiv-aids. [2]“Global HIV & AIDS Statistics — Fact Sheet.” Www.unaids.org, 2023, www.unaids.org/en/resources/factsheet#:~:text=Global%20HIV%20statistics&text=29.8%20million%20people%20were%20accessing. Accessed 15 Oct. 2023. [3] Günthard H.F., Calvez V., Paredes R., Pillay D., Shafer R.W., Wensing A.M., Jacobsen D.M., Richman D.D. Human immunodeficiency virus drug resistance: 2018 recommendations of the international antiviral society-USA panel. Clin. Infect. Dis. 2019;68:177–187. doi: 10.1093/cid/ciy463 [4] “Illumina COVIDSeq RUO Kits Reference Guide (1000000126053 v08)Illumina COVIDSeq Research Use Only Kits Documentation. COVIDSeq Assay (96 samples) | Low-throughput COVID-19 surveillance (illumina.com). 2022

Guidelines
Follow the manufacturer's specifications and guidelines.
Materials
HIV 1 Primers:

ABC
Well PositionNameSequence
A1HIV-1_v1.0_1_LEFTTGGTTAGACCAGATCTGAGCCT
A2HIV-1_v1.0_1_RIGHTTTTCTTTCCCCCTGGCCTTAAC
A3HIV-1_v1.0_3_LEFTGCTTTAGACAAGATAGAGGAAGAGCA
A4HIV-1_v1.0_3_RIGHTTTCCTGCTATGTCACTTCCCCT
A5HIV-1_v1.0_5_LEFTTTGGATGACAGAAACCTTGTTGG
A6HIV-1_v1.0_5_RIGHTAAGAAAATTCCCTGGCCTTCCC
A7HIV-1_v1.0_7_LEFTATTAGAAGAAATGAGTTTGCCAGGAA
A8HIV-1_v1.0_7_RIGHTTTCTTTATGGCAAATACTGGAGTATTGT
A9HIV-1_v1.0_9_LEFTGAGACACCAGGGATTAGATATCAGT
A10HIV-1_v1.0_9_RIGHTCCCTGGGTAAATCTGACTTGCC
A11HIV-1_v1.0_11_LEFTAGAGCCATTTAAAAATCTGAAAACAGGA
A12HIV-1_v1.0_11_RIGHTCAGTCTTCTGATTTGTTGTGTCAGT
B1HIV-1_v1.0_13_LEFTGTCAGTGCTGGAATCAGGAAAGT
B2HIV-1_v1.0_13_RIGHTCGTAGCACCGGTGAAATTGCT
B3HIV-1_v1.0_15_LEFTAGACATAATAGCAACAGACATACAAACT
B4HIV-1_v1.0_15_RIGHTCCAATCTAGCATCCCCTAGTGG
B5HIV-1_v1.0_17_LEFTCAAGCAGGACATAACAAGGTAGGA
B6HIV-1_v1.0_17_RIGHTTCCAGGGCTCTAGTCTAGGATC
B7HIV-1_v1.0_19_LEFTTCTCTATCAAAGCAGTAAGTAGTACATGT
B8HIV-1_v1.0_19_RIGHTGCATGTGTGGCCCAAACATTAT
B9HIV-1_v1.0_21_LEFTAGCGGGAGAATGATAATGGAGAA
B10HIV-1_v1.0_21_RIGHTGCATTGTCCGTGAAATTGACAGA
B11HIV-1_v1.0_23_LEFTAGCTAGCAAATTAAGAGAACAATTTGGA
B12HIV-1_v1.0_23_RIGHTTTCACTTCTCCAATTGTCCCTCA
C1HIV-1_v1.0_25_LEFTCTATTGAGGCGCAACAGCATCT
C2HIV-1_v1.0_25_RIGHTACCTACCAAGCCTCCTACTATCA
C3HIV-1_v1.0_27_LEFTACCACCGCTTGAGAGACTTACT
C4HIV-1_v1.0_27_RIGHTTGCTCCATGTTTTTCCAGGTCT
C5HIV-1_v1.0_29_LEFTCACACACAAGGCTACTTCCCTG
C6HIV-1_v1.0_29_RIGHTAACCAGAGAGACCCAGTACAGG
F1HIV-1_v1.0_2_LEFTTAGAAGGAGAGAGATGGGTGCG
F2HIV-1_v1.0_2_RIGHTTTTTGGCTGACCTGATTGCTGT
F3HIV-1_v1.0_4_LEFTGCTGCAGAATGGGATAGAGTGC
F4HIV-1_v1.0_4_RIGHTTTCTTCTAGTGTAGCCGCTGGT
F5HIV-1_v1.0_6_LEFTGGAAGGACACCAAATGAAAGATTGT
F6HIV-1_v1.0_6_RIGHTTGTCCACAGATTTCTATGAGTATCTGA
F7HIV-1_v1.0_8_LEFTAGTAGAAATTTGTACAGAGATGGAAAAGG
F8HIV-1_v1.0_8_RIGHTAAGGCTCTAAGATTTTTGTCATGCT
F9HIV-1_v1.0_10_LEFTCAGCCTATAGTGCTGCCAGAAA
F10HIV-1_v1.0_10_RIGHTTTTGCACTGCCTCTGTTAATTGT
F11HIV-1_v1.0_12_LEFTGGGAGACTAAATTAGGAAAAGCAGGA
F12HIV-1_v1.0_12_RIGHTAGCCATTGCTCTCCAATTACTGT
G1HIV-1_v1.0_14_LEFTGGGCAGGAAACAGCATATTTTCT
G2HIV-1_v1.0_14_RIGHTTGCTGTCCCTGTAATAAACCCG
G3HIV-1_v1.0_16_LEFTGGGAAAGCTAGGGGATGGTTTT
G4HIV-1_v1.0_16_RIGHTTCGTAACACTAGGCAAAGGTGG
G5HIV-1_v1.0_18_LEFTGCAACAACTGCTGTTTATCCATTTT
G6HIV-1_v1.0_18_RIGHTTTTCCTATATTCTATGATTACTATGGACCAC
G7HIV-1_v1.0_20_LEFTTACCTGTGTGGAAGGAAGCAAC
G8HIV-1_v1.0_20_RIGHTTGCATATTCTTTCTGCACCTTACCT
G9HIV-1_v1.0_22_LEFTGCCAGTAGTATCAACTCAACTGCT
G10HIV-1_v1.0_22_RIGHTACAGTAGAAAAATTCCCCTCCACA
G11HIV-1_v1.0_24_LEFTGGGCTGCTATTAACAAGAGATGGT
G12HIV-1_v1.0_24_RIGHTAGGTATCTTTCCACAGCCAGGA
H1HIV-1_v1.0_26_LEFTTGGGCAAGTTTGTGGAATTGGT
H2HIV-1_v1.0_26_RIGHTACCAATATTTGAGGGCTTCCCAC
H3HIV-1_v1.0_28_LEFTTGGATGGCCTACTGTAAGGGAA
H4HIV-1_v1.0_28_RIGHTAGCTTGTAGCACCATCCAAAGG
Sequencing libraries were prepared using reagents in the Illumina COVIDSeq Assay (RUO) kit with a protocol modified by substituting SARS-CoV-2 primers with HIV-1 primers.
Sample Extraction

HIV-1 subtype B positive culture control ZeptoMetrix (Part #v0801032CF), was extracted via the Qiagen Advanced XL DSP kit on the EZ1 extractor and serially diluted to the following concentration: 10ᶺ(-1), 10ᶺ(-2), 10ᶺ(-3), 10ᶺ(-4), 10ᶺ(-5), and 10ᶺ(-6), Undiluted control (1.74*10^10 IU/mL or 2.09*10^10 ng/ml); Sample was diluted 1:10 = 2.09*10^9 ng/ml before extraction.
Prepare the HIV-1 primer pool as described by the manufacturer. Individual primers were obtained from IDT as desalted, lab-ready stock at 100mM concentration. Dilute each primer at ratios provided by the manufacturer. Dilute the primer pool to get a 15 µM working concentration.
Procedure

Anneal RNA:
Prepare the following consumables:
ABC
Reagent Storage Instructions
EPH3 HT -25°C to -15°C Thaw at room temperature, invert to mix, and quick spin before use.
Save the following HIVSeq Anneal program on the thermal cycler:
  • Choose the preheat lid option
  • Set the reaction volume to 17 µl
  • 65°C for 3 minutes
  • Hold at 4°C

  1.  Label new PCR plate CDNA1.
  2. Add 8.5 µl EPH3 to each well.
  3. Add 8.5 µl eluted sample to each well.
  4. Seal and shake at 1600 rpm for 1 minute.
  5. Centrifuge at 1000 × g for 1 minute.
  6. Place on the preprogrammed thermal cycler and run the HIVSeq Anneal program.
Synthesize First Strand cDNA:
Prepare the following consumables:
ABC
Reagent Storage Instructions
RVT HT -25°C to -15°C Invert to mix before use. Keep on ice.
FSM HT -25°C to -15°C Thaw and bring to room temperature. Invert to mix, and then keep on ice.
Save the following HIVSeq FSS program on the thermal cycler:

  • Choose the preheat lid option
  • Set the reaction volume to 25 µl
  • 25°C for 5 minutes
  • 50°C for 10 minutes
  • 80°C for 5 minutes
  • Hold at 4°C

Procedure

  1. In a 1.7 ml tube, combine the following volumes to prepare First Strand cDNA Master Mix. Multiply each volume by the number of samples.
  • FSM HT (9 µl)
  • RVT HT (1 µl)
Reagent coverage is included to account for small pipetting errors.
2. Add 8 µl master mix to each well of the CDNA1 plate.
3. Add 17 µl annealed nucleic acid to the CDNA1 plate. 4. Seal and shake at 1600 rpm for 1 minute.
5. Centrifuge at 1000 × g for 1 minute.
6. Place on the preprogrammed thermal cycler and run the HIVSeq FSS program

SAFE STOPPING POINT:  If you are stopping, seal the plate and store at -25°C to -15°C for up to 7 days.
Amplify cDNA:
Prepare the following consumables:
ABC
Reagent Storage Instructions
CPP1 -25°C to -15°C Thaw at room temperature. Keep on ice until use.
CPP2 -25°C to -15°C Thaw at room temperature. Keep on ice until use.
IPM HT -25°C to -15°C Thaw at room temperature, and then invert to mix. Keep on ice until use.
Save the following HIVSeq PCR program on the thermal cycler:
  • Choose the preheat lid option
  • Set the reaction volume to 25 µl
  • 98°C for 3 minutes
  • 35 cycles of:   98°C for 15 seconds
63°C for 5 minutes
  • Hold at 4°C

Procedure:
1. Label two new PCR plates HIV1 and HIV2. The plates represent two separate PCR reactions on each sample and control in the CDNA1 plate.

2. In a 1.5 ml tube, combine the following volumes to prepare HIVSeq PCR 1 Master Mix and HIVSeq PCR 2 Master Mix. Multiply each volume by the number of samples. Reagent coverage is included to account for small pipetting errors.
ABC
Reagent HIV-1 PP1 Master Mix (µl) HIV-1 PP2 Master Mix (µl)
IPM HT 15 15
HIV-1 Primer Pool 1 4.3 N/A
HIV-1 Primer Pool 2 N/A 4.3
Nuclease-free water 4.7 4.7
3. Add 20 µl HIV-1 PP1 Master Mix to each well of the HIV1 plate corresponding to each well of the CDNA1 plate.
4. Add 5 µl first strand cDNA synthesis from each well of the CDNA1 plate to the corresponding well of the HIV1 plate.
5. Add 20 µl HIV-1 PP2 Master Mix to each well of the HIV2 plate corresponding to each well of the CDNA1 plate.
6. Add 5 µl first strand cDNA synthesis from each well of the CDNA1 plate to the corresponding well of the HIV2 plate.
7. Seal and shake at 1600 rpm for 1 minute.
8. Centrifuge at 1000 x g for 1 minute.
9. Place in the preprogrammed thermal cyclers and run the HIVSeq PCR program.

SAFE STOPPING POINT If you are stopping, store at -25°C to -15°C for up to 3 days.
Tagment PCR Amplicons
Prepare the following consumables:
ABC
Reagent Storage Instructions
EBLTS HT 2°C to 8°C Bring to room temperature. Vortex thoroughly before use.
TB1 HT -25°C to -15°C Bring to room temperature. Vortex thoroughly before use.
1. If HIV1 and HIV2 plates were stored frozen, prepare as follows.
a. Thaw at room temperature.
b. Check seals, and then shake at 1600 rpm for 1 minute.
c. Centrifuge at 1000 x g for 1 minute.

2. Save the following HIVSeq TAG program on the thermal cycler:
  • Choose the preheat lid option
  • Set the reaction volume to 50 µl
  • 55°C for 5 minutes
  • Hold at 10°C

Procedure:
1. Label a new PCR plate TAG1.
2. Combine HIV1 and HIV2 as follows.
a. Transfer 10 µl from each well of the HIV1 plate to the corresponding well of the TAG1 plate.
b. Transfer 10 µl from each well of the HIV2 plate to each well of the TAG1 plate containing HIV1.
3. In a 1.5 ml tube, combine the following volumes to prepare Tagmentation Master Mix. Multiply each volume by the number of samples.
  • TB1 HT (12 µl)
  • EBLTS HT (4 µl)
  • Nuclease-free water (20 µl)
4. Add 30 µl master mix to each well in TAG1 plate.
5. Seal and shake at 1600 rpm for 1 minute.
6. Place on the preprogrammed thermal cycler and run the HIVSeq TAG program.
Post Tagmentation Clean Up: Prepare the following consumables:
ABC
Reagent Storage Instructions
ST2 HT Room temperature Vortex before use.
TWB HT 2°C to 8°C Vortex before use.

Procedure:
1. Centrifuge the TAG1 plate at 500 x g for 1 minute.
2. Add 10 µl ST2 HT to each well of the TAG1 plate.
3. Seal and shake at 1600 rpm for 1 minute.
4. Incubate at room temperature for 5 minutes.
5. Centrifuge at 500 × g for 1 minute.
6. Place on the magnetic stand and wait until the liquid is clear (~3 minutes).
7. Inspect for bubbles on the seal. If present, centrifuge at 500 x g for 1 minute, and then place on the magnetic stand (~3 minutes).
8. Remove and discard all supernatant
9. Wash beads as follows.
a. Remove from the magnetic stand.
b. Add 100 µl TWB HT to each well.
c. Seal and shake at 1600 rpm for 1 minute.
d. Centrifuge 500 × g for 1 minute.
e. Place on the magnetic stand and wait until the liquid is clear (~3 minutes).
f. For first wash only, remove and discard all supernatant from each well.
10. Wash beads a second time. Leave supernatant in plate for second wash to prevent beads from over drying.
Amplify Tagmented Amplicons:
Prepare the following consumables:
ABC
Reagent Storage Instructions
EPM HT -25°C to -15°C Invert to mix. Keep on ice until use
Index adapters -25°C to -15°C Thaw at room temperature. Vortex to mix, and then centrifuge at 1000 × g for 1 minute.
1. Open each prepared index adapter plate seal as follows. Use a new PCR plate for each different index set.
a. Align a new 96-well PCR plate above the index adapter plate, and then press down to puncture the foil seal.
b. Discard the PCR plate.
2. Save the following HIVSeq TAG PCR program on the thermal cycler:
  • Choose the preheat lid option and set to 100°C
  • Set the reaction volume to 50 µl
  • 72°C for 3 minutes
  • 98°C for 3 minutes
  • 7 cycles of:
o 98°C for 20 seconds
o 60°C for 30 seconds
o 72°C for 1 minute
  • 72°C for 3 minutes
  • Hold at 10°C

Procedure:
1. In a 1.5 ml tube, combine the following volumes to prepare PCR Master Mix. Multiply each volume by the number of samples.
  • EPM (22 µl)
  • Nuclease-free water (22 µl)
2. Vortex PCR Master Mix to mix.
3. Keep the TAG1 plate on magnetic stand and remove and discard TWB HT without disturbing the beads.
4. Use a 20 µl pipette to remove any remaining TWB HT.
5. Remove the TAG1 plate from the magnetic stand.
6. Add 40 µl PCR Master Mix to each well.
7. Add 10 µl index adapters to each well of the PCR plate.
8. Seal and shake at 1600 rpm for 1 minute.
9. If liquid is visible on the seal, centrifuge at 500 x g for 1 minute.
10. Inspect to make sure beads are resuspended. To resuspend, set your pipette to 35 µl with the plunger down, and then slowly pipette to mix.
11. Place on the preprogrammed thermal cycler and run the HIVSeq TAG PCR program.
Pool and Clean Up Libraries
Prepare the following consumables:
ABC
Reagent Storage Instructions
ITB or IPB Room temperature Vortex thoroughly to mix.
RSB HT 2°C to 8°C Let stand for 30 minutes to bring to room temperature. Vortex and invert to mix
Prepare 3.0 ml 80% EtOH from absolute EtOH for each tube of pooled libraries.

Procedure for Illumina HIVSeq Assay (96 Samples):

1. Centrifuge the TAG1 plate at 500 × g for 1 minute.
2. Place on the magnetic stand and wait until the liquid is clear (~3 minutes).
3. To pool libraries, complete the following steps appropriate for your kit. Repeat the steps for each additional sample plate.
a. Label a new 1.7 ml tube Pooled ITB.
b. Transfer 5 µl library from each well of the TAG 1 plate into the Pooled ITB tube.
4. Vortex the Pooled IPB tubes to mix, and then centrifuge briefly.
5. Vortex ITB to resuspend.
6. Add ITB using the resulting volume of Pooled ITB tube volume multiplied by 0.9. For example, for 96 samples, add 432 µl ITB to each tube.
7. Vortex to mix.
8. Incubate at room temperature for 5 minutes.
9. Centrifuge briefly.
10. Place on the magnetic stand and wait until the liquid is clear (~5 minutes).
11. Remove and discard all supernatant.
12. Wash beads as follows.
a. Keep on the magnetic stand and add 1000 µl fresh 80% EtOH to each tube.
b. Wait 30 seconds.
c. Remove and discard all supernatant.
13. Wash beads a second time.
14. Use a 20 µl pipette to remove all residual EtOH. 15. Add 55 µl RSB HT.
16. Vortex to mix, and then centrifuge briefly.
17. Incubate at room temperature for 2 minutes.
18. Place on the magnetic stand and wait until the liquid is clear (~2 minutes).
19. Transfer 50 µl supernatant from each Pooled IPB tube to a new microcentrifuge tube.

SAFE STOPPING POINT If you are stopping, cap the tube and store at -25°C to -15°C for up to 30 days.
Quantify and Normalize Libraries

1. Analyze 2 µl library pool using a Qubit dsDNA HS Assay kit. If libraries are outside the standard range, dilute to 1:10 concentration and analyze again.

2. Dilute each library pool to a minimum of 50 µl at a normalized concentration 2 nM using RSB according to manufacturer specifications.

Pool and Dilute Libraries:
After diluting to the starting concentration of 2 nM, libraries are ready to be denatured and diluted to the final loading concentration according to the specifications of the Illumina sequencing platform.