Mar 31, 2026
Adapted Tn-Seq Library Prep Protocol with Tagmentation
- Emily Knebel1,
- Nathan Bivens1,
- Pamela Brown1
- 1University of Missouri - Columbia
Protocol Citation: Emily Knebel, Nathan Bivens, Pamela Brown 2026. Adapted Tn-Seq Library Prep Protocol with Tagmentation. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvo9ewdv4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 02, 2025
Last Modified: March 31, 2026
Protocol Integer ID: 123640
Keywords: Tn-Seq, Illumina DNA Prep Tagmentation, Transposon Sequencing DNA Prep, Tn5, adaptation of the illumina dna prep, illumina dna prep, tn5 transposon insertion, ligating illumina adaptor sequence, illumina adaptor sequences for further processing, seq library prep protocol with tagmentation, transposon insertion, sequencing experiment, dna source, illumina index, seq library prep protocol, tagmentation protocol, pcr amplification step, tagmentation protocol for use, following illumina, adapted tn, transposon, tn5, tn51
Funders Acknowledgements:
University of Missouri Office of Research, Graduate Studies, and Economic Development
Grant ID: Research Core Facilities Grant Award, DNA Core Tier 1 NovSeq Grant
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol is an adaptation of the Illumina DNA Prep, Tagmentation protocol for use with Tn5-Transposon Insertion Sequencing experiments. The adaptations use transposome-linked beads to tagment the DNA source, simultaneously fragmenting and ligating Illumina adaptor sequences for further processing. Three PCR amplification steps are included to first enrich for the Transposon (Tn51) and the unique Adaptor 1 sequence, followed by restoration of the original Adaptor 1 sequence, then finally adding the Illumina indexes for sequencing. This protocol follows the 24 dual unique index pair approach, but this approach can be scaled up following Illumina's 96 well plate materials and instructions.
Attachments
Guidelines
Note: It is strongly encouraged that all instructions provided in the Illumina DNA Prep kit are reviewed first and followed where applicable. While much of the kit’s protocols are described here, additional information, including preparation of materials and troubleshooting guides are described by Illumina.
There will be three amplification steps using custom primers to enrich for the transposon junction. PCR materials include both Illumina Enhanced PCR Mix and 2X KapaHiFi HotStart ReadyMix. Clean-up will be using Illumina Sample Purification or AmPure XP beads.
Materials
Illumina DNA prep, Tagmentation kit (Cat. No. 20060060)
PCR plastics
Ampure XP beads
Magnetic 96 rack fitting PCR tubes
200 proof pure EtOH - fresh, not opened for longer than a few weeks
Primers:
1st Amp:
Tn-Specific1 Random Hybrid ACCTGGGCACGCGACGACGCTCTTCCGATCTGG
Shortened Adaptor 12 TCGTCGGCAGCGTCA
2nd Amp:
Adaptor 2-Random hybrid2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTGGGCACGCG
Full-length Adaptor 12 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
3rd Amp:
Illumina Index 1 CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Illumina Index 2 AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
Nuclease-free H2O
Gel electrophoresis materials
2X KAPA HiFi HotStart ReadyMix
*The 2X ReadyMix contains KAPA HiFi HotStart DNA Polymerase (0.5 U per 25 µL reaction) in a proprietary reaction buffer containing dNTPs (0.3 mM of each dNTP at 1X), MgCl2 (2.5 mM at 1X) and stabilizers.
Troubleshooting
Before start
DNA Input
Ensure that
DNA input is of pure quality by assessment of the UV absorbance ratio.
260 / 280 nm = 1.8 – 2.0
260 / 230 nm = 2.0 – 2.2
Dilute samples so that a volume of 2 – 30 µl contains 100 – 500 ng of DNA.
Ideally, 30 µl will be used, so base calculations on that volume.
Tagmentation
Let the following components warm to room temperature:
a. Bead-Linked Transposomes (BLT)
b. Tagmentation Buffer (TB1)
Once thawed, vortex both of these well.
Set up the thermocycler for the following custom Tag program:
Preheat lid at 100˚C
55˚C for 15 mins
Hold at 10˚C
Prepare the tagmentation master mix (volumes account for residual) and multiply the number of samples used:
a. 11 µl BLT
b. 11 µl TB1
Add 20 µl of the tagmentation master mix to each 30 µl diluted sample of DNA in PCR tubes/96 well plate. Total reaction volume is 50 µl.
Place tubes/plate in the thermocycler and run the custom Tag program.
Tagmentation Clean-Up
Prepare the following buffer: Tagmentation Stop Buffer (TSB)
a. If the TSB precipitates, heat it to 37˚C for 10 minutes then vortex and cool to room temperature.
Set up the following Stop Tagmentation protocol on the thermocycler:
a. Preheat lid at 100˚C
b. 37˚C for 15 minutes
c. Hold at 10 ˚C
Add 10 µl of TSB to each tube/well from tagmentation reaction
a. Resuspend the beads by pipetting slowly 10 times
Return tubes/plate to thermocycler and run the Stop Tag protocol.
Place the tubes on a magnetic rack and wait until the liquid clears ~2 – 5 mins
Aspirate and discard the supernatant.
Wash step:
a. Remove the tube/plate from magnetic stand.
b. Add 100 µl Tagmentation Wash Buffer to the beads, pipetting slowly to avoid foaming
c. Pipet slowly to resuspend
d. Place tubes/plate back on magnetic stand and wait until clears again
e. Remove & discard the supernatant
Repeat the wash steps except do not remove supernatant at final step until ready for amplification!!
a. Do not let the beads dry out!
1st PCR Amplification
Thaw the Illumina enhanced PCR mix (EPM), invert to mix and centrifuge. Thaw primers: Tn-specific Random Hybrid and Shortened Adaptor 1
Set up the following program as Tn-Amplification 1 on the thermocycler
a. Preheat lid to 100˚C
b. Start
i. 68˚C 3:00 (min:sec)
ii. 98˚C 3:00
c. First 5 cycles
i. 98˚C 0:45
ii. 60˚C 0:45
iii. 68˚C 2:00
d. 15 more cycles
i. 98˚C 0:15
ii. 62˚C 0:45
iii. 68˚C 0:30
On the last cycle for the final extension step, set it to be 10 minutes
e. Hold at 4˚C
Prepare the Illumina Enhanced PCR (EPM) Master mix and multiple each volume by the number of samples being used. (volumes account for residual)
a. 22 µl EPM
b. 22 µl nuclease-free water
c. 5 µl Tn-specific hybrid primer
d. 5 µl Shortened Adaptor 1 primer
Vortex then centrifuge the master mix to bring down droplets at 280 g for 10 seconds
With bead-linked tagmented samples ready, remove & discard the supernatant while on the magnetic stand.
Remove from magnet stand
Immediately add 50 µl of PCR master mix to each sample tube/well
Pipet to mix until fully resuspended then centrifuge for 3 seconds. Place in thermocycler and run the Tn-Amplification 1 program
Clean-Up Post 1st Amplification
Bring Ampure XP beads to room temperature. Thaw Resuspension Buffer (RSB) to room temp.
Make 80% EtOH from pure ethanol stock
Centrifuge the bead-linked transposome reaction after amplification at 280 G x 1 min
Place tubes/plate on magnetic stand and wait until clears ~3 mins
Transfer 45 µl of the supernatant to a microcentrifuge tube or 96 well ml deepwell storage (midi) plate
Before bead cleanup – assess reaction success by running the remaining 5 µl an agarose gel – add loading dye at appropriate ratio. Aim to see DNA of numerous sizes, most > 350 bp
Vortex & invert the Ampure stock solution before transferring 45 µl of these beads to each tube/well
a. This accounts for a 1:1 ratio
Pipet each tube/well ten times or on shaker for 1 min.
a. Solution is viscous, pipet slowly
Incubate at room temp for 5 mins
Place tubes/plate on magnetic stand and allow to clear
Remove & discard the supernatant
Wash the beads twice:
a. Add 200 µl of fresh 80% EtOH to the beads while they are on the magnet stand
i. Do NOT mix or disturb beads!!
b. Incubate for 30 sec
c. Remove & discard the supernatant
d. Repeat for second wash
e. After second wash, all beads to air dry for 5-15 minutes
Remove tubes from magnetic stand. Add 32 µl of resuspension buffer and pipet to resuspend.
Incubate at room temp for 2 mins
Place back on magnet stand and allow to clear
Transfer 20 µl to a new PCR tube/plate for each sample.
a. Store remaining 10-12 µl of cleaned up library sample at -20˚C. It is safe to store purified samples for 1 month at -20˚C
2nd PCR Amplification
Thaw KAPA HiFi 2X Ready Mix, invert several times to mix and centrifuge down briefly.
Thaw primers: Adaptor 2 hybrid and Shortened Adaptor 1.
Set up the following program as Tn-Amplification 2 on the thermocycler
a. Preheat lid to 100˚C
b. Start
i. 68˚C 3:00 (min:sec)
ii. 98˚C 3:00
c. 5 cycles
i. 98˚C 0:45
ii. 62˚C 0:30
iii. 68˚C 2:00
d. Final cycle extension step: 68˚C for 1:00
e. Hold at 4˚C
Prepare the PCR Master mix and multiple each volume by the number of samples being used. (volumes do not account for residual)
a. 25 µl KAPA HiFi 2X ReadyMix
b. 3 µl nuclease-free water
c. 1 µl Adaptor 2 hybrid primer
d. 1 µl Full-length Adaptor 1 primer
Vortex then centrifuge the master mix to bring down droplets at 280 g for 10 seconds.
Add 30 µl of the master mix to 20 µl of each library samples generated from first amplification.
Place in thermocycler and run the Tn-Amplification 2 program
2nd Clean-Up (Same as 1st)
Add 1:1 volume (50 µl to 50 µl reaction volume) of room temperature Sample Purification Beads directly to each PCR reaction sample.
Incubate 15 minutes
Place on magnetic rack and allow to clear.
Leave tube(s) on magnetic rack and perform the 80% EtOH wash steps
a. Add 200 µl of 80% EtOH to tubes without disturbing beads
b. Incubate 30 seconds then discard supernatant
c. Repeat for a total of two washes
d. Allow to air dry for 5 minutes then remove from magnetic stand
Resuspend in either 32 µl of Resuspension buffer or EB Buffer (Tris-HCl pH 8-8.5)
Place tubes on magnetic stand until clear
Transfer 20 µl the supernatant to a new tube without any beads.
Store 10-12 µg of 2nd round amplicons at -20˚C
3rd PCR Amplification
Thaw KAPA HiFi 2X Ready Mix, invert several times to mix and centrifuge down briefly. Thaw primers: Adaptor 2 hybrid and Shortened Adaptor 1.
Set up the following program as Tn-Amplification 3 on the thermocycler
a. Preheat lid to 100˚C
b. Start
i. 68˚C 3:00 (min:sec)
ii. 98˚C 3:00
c. 5 cycles
i. 98˚C 0:45
ii. 62˚C 0:30
iii. 68˚C 2:00
d. Final cycle extension step: 68˚C for 1:00
e. Hold at 4˚C
Prepare the PCR Master mix and multiple each volume by the number of samples being used. (volumes do not account for residual)
a. 25 µl KAPA HiFi 2X ReadyMix
b. 3 µl nuclease-free water
Vortex then centrifuge the master mix to bring down droplets at 280 g for 10 seconds.
Add appropriate index adaptors to each sample using the Adaptor Pooling Guide
a. 1 µl Index with i7
b. 1 µl Index with i5
c. Alternatively: 2.5 µl of each i7 and i5 index and 0 µl H2O to master mix
Add 30 µl of the master mix to 20 µl of each library samples generated from second amplification.
Mix by pipetting then spin down. Place in thermocycler and run the Tn-Amplification 3 program
3rd Clean-Up
Repeat Clean-Up as Previously listed in steps 45-51
Final Steps Before Sequencing
Store 10-12 µl of 3rd round amplicons at -20˚C
Individually or in combination, take 5 µl of each library, vortex & centrifuge. Quantify by Qubit (follow manufacturer instructions for preparation).
Submit 20 – 30 µl of final sample for fragment analysis and sequencing on appropriate platform.
Protocol references
1. Sternon JF, Godessart P, Gonçalves de Freitas R, et al. Transposon Sequencing of Brucella abortus Uncovers Essential Genes for Growth In Vitro and Inside Macrophages. Infection and Immunity. 2018;86(8):10.1128/iai.00312-18. doi:10.1128/iai.00312-18
2. Illumina Adapter Sequences. https://support-docs.illumina.com/SHARE/AdapterSequences/Content/SHARE/FrontPages/AdapterSeq.htm.
Acknowledgements
We express our acknowledgements for the sequencing expertise of Nathan Bivens and the University of Missouri Genomics Technology Core for collaboratively developing this adapted protocol.