Dec 22, 2025
Accurate detection of somatic mutations in single cells by scNanoSeq
- Muchun Niu1,
- Yang Zhang1,
- Jiayi Luo1,
- Chenghang Zong1
- 1Baylor College of Medicine
External link: https://www.biorxiv.org/content/10.1101/2023.10.09.561356v1
Protocol Citation: Muchun Niu, Yang Zhang, Jiayi Luo, Chenghang Zong 2025. Accurate detection of somatic mutations in single cells by scNanoSeq. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9be5ml3e/v1
Manuscript citation:
Niu, M., Zhang, Y., Luo, J., Sinson, J. C., Thompson, A. M., & Zong, C. (2023). Characterization of cancer evolution landscape based on accurate detection of somatic mutations in single tumor cells. bioRxiv, 2023-10.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 19, 2025
Last Modified: December 22, 2025
Protocol Integer ID: 235394
Keywords: cell whole genome amplification method, cell genome amplification method, whole genome amplification method, accurate detection of somatic mutation, somatic mutations in individual human cell, detecting somatic mutation, errors per human genome, somatic mutation, single cell, human genome, cell expansion experiment, sequencing scheme, mutation, individual human cell, nanoseq chemistry, based nanoseq chemistry
Funders Acknowledgements:
NIH Director’s New Innovator Award
Grant ID: 1DP2EB020399
NIH SMaHT Program
Grant ID: 1UG3NS132132
McNair Scholarship
NIH SMaHT Program
Grant ID: 1UM1DA058229-01
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Accurately detecting somatic mutations in individual human cells poses a significant challenge for single-cell whole genome amplification methods. In this study, we introduce a novel single-cell genome amplification method based on the restriction enzyme-based NanoSeq chemistry, achieving an error rate of less than 10-10 in mutation calling (equivalent to 0.2 errors per human genome). We term this methodology as scNanoSeq. This precision is derived from theoretical error rate analyses within the duplexing sequencing scheme, which aligns with upper bound estimations derived from single-cell expansion experiments.
Protocol materials
1M KClbioworldCatalog #40120947-1
NP-40 Surfact-Amps™ Detergent SolutionThermo Fisher ScientificCatalog #85124
0.5M EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #E7889-100ML
QIAGEN Protease (7.5 AU)QiagenCatalog #19155
Molecular grade water Catalog #BP561-1 1L
1M Tris-HCI, pH 8.0Thermo Fisher ScientificCatalog #15568025
10% Triton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #93443-100ML
rCutSmart BufferNew England BiolabsCatalog #B6004S
HpyCH4V - 500 unitsNew England BiolabsCatalog #R0620L
Nuclease free water
CutSmart® BufferNew England BiolabsCatalog #B7204S
NEBuffer 4 - 5.0 mlNew England BiolabsCatalog #B7004S
Klenow Fragment (3'-5' exo-) - 1,000 unitsNew England BiolabsCatalog #M0212L
Adenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
15 μM xGen CS adapterIntegrated DNA Technologies, Inc. (IDT)Catalog #1080799
T4 DNA LigaseNew England BiolabsCatalog #M0202L
Ampure XP beadsBeckmanCatalog #A63881
iTaq Universal SYBR Green SupermixBio-Rad LaboratoriesCatalog #172-5112
NEBNext UltraII Q5 Master MixNew England BiolabsCatalog #M0544X
Troubleshooting
1. Single cell lysis
3h 55m
Prepare 1000 µL Protease Lysis Mix.
30 µL of1M Tris-HCI, pH 8.0Thermo Fisher ScientificCatalog #15568025
4 µL of 0.5M EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #E7889-100ML
20 µL of 1M KClbioworldCatalog #40120947-1
10 µL of 10% Triton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #93443-100ML
36 µL of NP-40 Surfact-Amps™ Detergent SolutionThermo Fisher ScientificCatalog #85124
400 µL of 20 mg/mL QIAGEN Protease (7.5 AU)QiagenCatalog #19155
500 µL of Molecular grade water Catalog #BP561-1 1L
5m
Aliquot 2.5 µL of Protease Lysis Mix in each low-binding PCR tubes.
20m
FACS sort individual cells/nuclei into PCR tubes containing Protease Lysis Mix.
1h
Brief centrifugation, and run the following cell lysis program on a thermo-cycler.
50 °C 02:00:00
75 °C 00:20:00
85 °C 00:05:00
4 °C Hold
2h 30m
Store the lysed cells at -80 °C .
Genome fragmentation
50m
Prepare the following Fragmentation Mix (2.5 uL per cell).
0.5 µL of CutSmart® BufferNew England BiolabsCatalog #B7204S or rCutSmart BufferNew England BiolabsCatalog #B6004S
0.15 µL of HpyCH4V - 500 unitsNew England BiolabsCatalog #R0620L
1.85 µL of Nuclease free water
5m
Add 2.5 uL of Fragmentation Mix to each tube along the wall, tap to mix, and then centrifuge.
Run the following program on a thermo-cycler.
37 °C 00:15:00
65 °C 00:20:00
45m
End repair
45m
Prepare the following End Repair Mix (10 uL per cell).
1 µL of NEBuffer 4 - 5.0 mlNew England BiolabsCatalog #B7004S
7.35 µL of Nuclease free water
0.15 µL of Klenow Fragment (3'-5' exo-) - 1,000 unitsNew England BiolabsCatalog #M0212L
5m
Add 10 uL of End Repair Mix to each tube along the wall, tap to mix, and then centrifuge.
Run the following program on a thermo-cycler.
37 °C 00:30:00
40m
Y-shape adapter ligation
1h 7m
Prepare the following Ligation Mix (22.4 uL per cell).
2.24 µL of NEBuffer 4 - 5.0 mlNew England BiolabsCatalog #B7004S
15.53 µL of Nuclease free water
3.74 µL of Adenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
0.33 µL of 15 μM xGen CS adapterIntegrated DNA Technologies, Inc. (IDT)Catalog #1080799
0.56 µL of T4 DNA LigaseNew England BiolabsCatalog #M0202L
5m
Add 22.4 uL of Ligation Mix to each tube along the wall, tap to mix, and then centrifuge.
Run the following program on a thermo-cycler.
20 °C 00:22:00
32m
Immediately after ligation, purify the ligation product with 0.95X Ampure XP beadsBeckmanCatalog #A63881 , and eluted in 15.5 µL of Nuclease free water .
To avoid sample loss, flick the tubes for all the mixing steps instead of pipetting.
30m
Library QC and amplification
4h
Use 0.5 µL of Purified ligation product for the following qPCR yield test.
5 µL of iTaq Universal SYBR Green SupermixBio-Rad LaboratoriesCatalog #172-5112 0.25 µL of 10 micromolar (µM) Truseq5 primer (ACACTCTTTCCCTACACGAC)
0.25 µL of 10 micromolar (µM) Truseq7 primer (GTGACTGGAGTTCAGACGTGT)
4 µL of Nuclease free water
0.5 µL Purified ligation product
Run qPCR on a Roche LightCycler 96 machine following the program:
94 °C for 00:02:00
30 cycles of
- 94 °C for 00:00:20
- 58 °C for 00:00:20
- 72 °C for 00:01:00
Melting Curve
For a typical diploid cells, qPCR Ct value is expected to be 17.5~18.5.
2h
For the cells with anticipated yield, use the remaining 15 µL of Purified ligation product for PCR amplification.
25 µL of NEBNext UltraII Q5 Master MixNew England BiolabsCatalog #M0544X
5 µL of 10 micromolar (µM) P5_index5_Truseq5 primer (AATGATACGGCGACCACCGAGATCTACAC[8-base-index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
5 µL of 10 micromolar (µM) P7_index7_Truseq7 primer
(CAAGCAGAAGACGGCATACGAGAT[8-base-index]GTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCT)
15 µL Purified ligation product
Run the following PCR program on a thermo-cycler:
98 °C for 00:00:30
17 cycles of
- 98 °C for 00:00:10
- 73 °C for 00:01:15
73 °C for 00:05:00
Purify the PCR product twice with 0.7X Ampure XP beadsBeckmanCatalog #A63881 , and eluted in 20 µL of Nuclease free water .
Pooled libraries are ready for sequencing on an Illumina NovaSeq 6000 / NovaSeq X / NovaSeq XPlus platform with 2×150 bp paired-end mode. The target depth is 5~6 reads per fragment based on pre-amplification qPCR quantification.
2h
Protocol references
1. Niu, M., Zhang, Y., Luo, J., Sinson, J. C., Thompson, A. M., & Zong, C. (2023). Characterization of cancer evolution landscape based on accurate detection of somatic mutations in single tumor cells. bioRxiv, 2023-10.
2. Abascal, F., Harvey, L. M., Mitchell, E., Lawson, A. R., Lensing, S. V., Ellis, P., ... & Martincorena, I. (2021). Somatic mutation landscapes at single-molecule resolution. Nature, 593(7859), 405-410.