Sep 06, 2022
AAVS1 Knock-in
- Hanqin Li1,
- Dirk Hockemeyer1
- 1University of California, Berkeley
External link: https://doi.org/10.7554/eLife.79208
Protocol Citation: Hanqin Li, Dirk Hockemeyer 2022. AAVS1 Knock-in. protocols.io https://dx.doi.org/10.17504/protocols.io.b37kqrkw
Manuscript citation:
Hanqin Li, Oriol Busquets, Yogendra Verma, Khaja Mohieddin Syed, Nitzan Kutnowski, Gabriella R Pangilinan, Luke A Gilbert, Helen S Bateup, Donald C Rio, Dirk Hockemeyer, Frank Soldner (2022) Highly efficient generation of isogenic pluripotent stem cell models using prime editing eLife 11:e79208
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 22, 2022
Last Modified: December 13, 2024
Protocol Integer ID: 57292
Keywords: ASAPCRN, safe harbor locus, term hpsc, aavs1 knock, constructs to the aavs1, hipsc, aavs1, hesc
Funders Acknowledgements:
Aligning Science Across Parkinson's
Grant ID: ASAP-000486
Abstract
This protocol describes the standard procedure to knock-in constructs to the AAVS1 safe harbor locus in hPSCs.
General Notes:
1. The AAVS1 knock-in construct, AAVS1-SA-neo-CAGGS-PE2-2A-GFP, can be found at AddGene (Catalog: 180014, RRID:Addgene_180014)
2. Throughout this protocol, the term hPSC is used to collectively refer to both hiPSCs and hESCs. All described procedures have been tested and work equally well for hiPSCs and hESCs.
Materials
| Item | Vendor | Catalog # | |
| G418 | Life Technologies | 11811031 | |
| PrimeStar GXL DNA polymerase | Takara | R050B | |
| DMEM/F12 | Thermo Fisher | 11320082 | |
| Fetal Bovine Serum (FBS) | Corning | 35-011-CV | |
| Knockout Serum Replacement | Thermo Fisher | 10828-028 | |
| L-Glutamine | Sigma | G8540 | |
| Penicillin & Streptomycin (100X) | Thermo Fisher | 15140163 | |
| MEM Non-Essential Amino Acids (100X) | Thermo Fisher | 11140050 | |
| Heat Stable Recombinant Human FGF2 | Thermo Fisher | PHG0360 | |
| 2-Mercaptoethanol | Sigma | M3148 | |
| Y-27632 | Chemdea | CD0141 | |
| BSA | Sigma | A4503 | |
| DMSO | Fisher Scientific | BP231-100 |
Note: This protocol makes reference to protocols in other collections. Please check for any materials found in those protocols, which might not be listed here
Troubleshooting
One day before nucleofection, prepare two DR4 MEFs 6-well plates.
Nucleofection of Cas9/sgRNA RNP (protospacer sequence, ACCCCACAGTGGGGCCACTA) and AAVS1 knock-in targeting vector is performed using the nucleofection of ribonucleoprotein (RNP) into human pluripotent stem cells (hPSCs) protocol as described in the collection "Nucleofection (Amaxa) and electroporation (Biorad) of hPSCs;" dx.doi.org/10.17504/protocols.io.b4qnqvve
After nucleofection, seed all cells onto two 6-well plates containing hPSCs medium + Rock Inhibitor.
hPSCs Medium
| A | B | |
| DMEM/F12 | 385 ml | |
| Fetal Bovine Serum (FBS) | 75 ml | |
| Knockout Serum Replacement | 25 ml | |
| L-Glutamine (100X) | 5 ml | |
| Penicillin & Streptomycin (100X) | 5 ml | |
| MEM Non-Essential Amino Acids (100X) | 5 ml | |
| 2-Mercaptoethanol (10,000X) | 50 µl | |
| Heat Stable Recombinant Human FGF2 (25µg/ml)* | 80 µl |
*While we prefer Heat Stable Recombinant Human FGF2, we also have used regular FGF2. Final volume: 500ml
L-Glutamine (100X)
| L-Glutamine, powder | 14.6 g | |
| MilliQ H2O | 500 ml |
2-Mercaptoethanol (10,000X)
| 2-Mercaptoethanol | 0.78 ml | |
| MilliQ H2O | 9.22 ml |
Heat Stable Recombinant Human FGF2 (25µg/ml)
| A | B | |
| Heat Stable Recombinant Human FGF2 | 500 µg | |
| 0.1% BSA | 20 ml |
Final volume: 20ml
Y-27632 (1,000X)
| Y-27632 | 5 mg | |
| DMSO | 1.56 ml |
hPSCs Medium + Rock Inhibitor
| A | B | |
| hPSCs medium | 500 ml | |
| Y-27632 (1,000X) | 500 µl |
Final volume: 500ml
From day 3, change medium daily for 10 days with hPSCs medium with 70 µg/ml G418. Most of the hPSCs will die during the G418 selection.
When large hPSC colonies emerge, manually pick and re-plate them individually in 12-well ICR MEFs plates, as described in the collection "Standard operating procedure for the isolation of genetically engineered hPSCs clones in a high-throughput way;” dx.doi.org/10.17504/protocols.io.b4mmqu46
When these expanded clones grow to 50%, passage 1/4 to a new well of a 6-well plate for further expanding.
For a detailed protocol on passaging hPSCs, refer to the collection "Thawing, Passaging and Freezing of hPSCs on MEFs;" dx.doi.org/10.17504/protocols.io.b4msqu6e
Prepare crude cell lysate from the rest of the cells for genotyping as described in the collection “Genotyping by next generation sequencing;" dx.doi.org/10.17504/protocols.io.b4n3qvgn
Freeze the expanded cells when they grow up.
For a detailed protocol on freezing hPSCs, refer to the collection "Thawing, Passaging and Freezing of hPSCs on MEFs;" dx.doi.org/10.17504/protocols.io.b4msqu6e
Genotype crude cell lysate from step 6 using the primers flanking each homologous arm with GXL DNA polymerase. Use unedited cells as a negative control.
Primer Sequences & Product Size
| Primers | Sequence | Product Size | |
| SP-AAVS1-HR-L | CCCGCTTCAGTGACAACGTC | 1313bp | |
| ASP-AAVS1-HR-L | GAACTCTGCCCTCTAACGCT | ||
| SP-AAVS1-HR-R | TGCATCGCATTGTCTGAGTAG | 1184bp | |
| ASP-AAVS1-HR-R | TACCCCGAAGAGTGAGTTTGC |
PCR with GXL DNA polymerase
PCR with GXL DNA polymerase - Setup
| A | B | |
| Ultrapure H2O | 11 µl | |
| 5x GXL buffer | 4 µl | |
| 2.5 mM dNTP | 1.6 µl | |
| 10 µM primer Forward | 0.5 µl | |
| 10 µM primer Reverse | 0.5 µl | |
| PrimeStar GXL DNA polymerase | 0.4 µl | |
| Crude cell lysis | 2 µl |
Touch-down PCR program
Touch-down PCR program
| A | B | |
| 98°C | 3 min | |
| 98°C | 30 s | |
| 70°C (touch down, 1C/cycle) | 30 s | |
| 72°C | 1 min | |
| Go to 2 | 12 cycles in total | |
| 98°C | 30 s | |
| 58°C | 1 min | |
| 72°C | 30 s | |
| Go to 6 | 23 cycles in total | |
| 72°C | 7 min | |
| 4°C or 12°C | forever |
Run PCR products in agarose gels.
Gel purify the bands of positively targeted clones and perform sanger sequencing to confirm.
Thaw and expand the correctly targeted clones
Test clones for mycoplasma, stain for pluripotent markers, and karyotype