Oct 28, 2025

A real-time PCR protocol for quantification of Nosema ceranae infection in honeybees

  • 1Institute of Systematics and Evolution of Animals, Polish Academy of Sciences
Icon indicating open access to content
QR code linking to this content
Protocol CitationWeronika Antoł, Monika Ostap-Chec 2025. A real-time PCR protocol for quantification of Nosema ceranae infection in honeybees. protocols.io https://dx.doi.org/10.17504/protocols.io.261gek8wjg47/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 17, 2025
Last Modified: October 28, 2025
Protocol  Integer ID: 230078
Keywords: Nosema ceranae, Hsp70, qPCR, nosemosis, Vairimorpha, nosema ceranae infection level in individual honeybee, nosema ceranae infection in honeybee, quantifying nosema ceranae infection level, absolute quantification of the pathogen, individual honeybee, hsp70 gene, base pairs fragment of the hsp70 gene, qpcr protocol, nosema ceranae infection, time pcr protocol for quantification, serial dilutions of the amplified broader hsp70 fragment, pathogen, number of spore, qpcr, amplified broader hsp70 fragment, honeybee, apis mellifera, spore, hsp70, bee, copies per bee, time pcr protocol, number of hsp70 copy
Funders Acknowledgements:
National Science Centre, Poland
Grant ID: Preludium UMO-2021/41/N/NZ8/02917
Abstract
  • The protocol is dedicated to detecting and quantifying Nosema ceranae infection level in individual honeybees (Apis mellifera).
  • It relies on real-time PCR (qPCR) absolute quantification of the pathogen’s Hsp70 gene.
  • Because Hsp70 is present in a single copy per spore, the number of Hsp70 copies can be directly translated into number of spores.
  • The qPCR protocol relies on SYBR Green chemistry.
  • The target is a 65 base pairs fragment of the Hsp70 gene.
  • For absolute quantification, each reaction plate includes a standard curve, based on serial dilutions of the amplified broader Hsp70 fragment than the target fragment (824 bp).
  • The method’s sensitivity is 800 copies per bee.
Guidelines
This protocol allows to analyse up to 23 samples per plate (when analysed in three technical replicates - recommended) or up to 35 samples per plate (in duplicates).
Protocol materials
Zymoclean™ Gel DNA Recovery KitZymo ResearchCatalog #D4001
Qubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853
Troubleshooting
Problem
Standard curve not linear; lowest standard concentrations fall below the line
Solution
Frequent reason: Standard degradation Solution: Prepare fresh standard dilutions. If this does not help, prepare fresh standard.
Problem
Additional peaks in the melting curve; especially in samples with low amount of target and in the NTC samples
Solution
Frequent reason: Primer-dimer formation Solutions: - Dilute the template - Dilute the primers - Increase the annealing temperature
Problem
The difference between technical replicates exceeds 1 Cq
Solution
Frequent reason: Pipetting errors Solution: Increase pipetting precision. Mix the DNA extract thoroughly before adding it on a plate.
1. Sample homogenization
Place: pre-PCR lab

Equipment:
  • Homogenizer: Omni Bead Ruptor Elite (for 24 samples)
  • Centrifuge
  • Gas burner
  • Metal spoon
  • Aluminium foil
  • Entomological forceps
  • Small scissors
  • Permanent marker
  • Pipettes (200 µl and 1000 µl)

Materials and reagents (per sample)
  • Vials: Screw cap tubes 2.0 ml, Sarstedt, cat. no. 72.694.006 (1)
  • dH2O (800 µl)
  • Beads: Omni International 2.8 mm (“big”) ceramic beads (2)
  • Omni International 0.5 mm (“small”) ceramic beads (1 metal spoon)
  • 200 µl wide-bore pipette tips (1) - ART Wide Bore Filtered Pipette Tips (Catalog number 2069GPK)
  • 1000 µl pipette tip (1 for all samples)
  • 1.5 ml Eppendorf tubes (1)
Homogenization steps
Label the vials on the side. Anything written on the cap will vanish during homogenization due to friction in the homogenizer.
Sterilize metal instruments in flame. For molecular analyses, it does need to be repeated between samples.
Gently hold the honeybee by the thorax with entomological forceps, then cut off the abdomen with scissors and place it in the vial.
Add the following materials to each sample vial:
  • 800 µl dH2O
  • 2 big beads
  • 1 spoon of small beads
Tightly screw the vial caps and place the samples in the homogenizer. Secure the sample holder (not too tight), secure the locker and close the device. The homogenizer accommodates up to 24 samples.
Turn on the homogenizer. Before starting the program, set the following parameters:
  • Volume: 2 ml
  • Speed: 5 m/s
  • 2 cycles
  • Time: 00:30
  • Dwell (break between cycles): 00:10
Remove the samples from the homogenizer. Vortex each homogenate thoroughly before sampling to prevent Nosema spores sedimentation. Immediately after vortexing, take 200 µl of homogenate with a wide-bore pipette tip and transfer to a fresh Eppendorf tube to be used for DNA extraction. If the homogenate is not processed further immediately, freeze until further use, if possible perform the digestion step first. This will help to prevent DNA degradation in the homogenate.
2. DNA extraction
3h 19m
Place: pre-PCR lab
Method: solution-based Promega kit Wizard Genomic DNA Purification Kit (promega.com) + proteinase K
Equipment:
  • Thermoblock - holds up to 24 samples.
  • Centrifuge. The largest rotor can accommodate up to 30 samples.
  • Vortex mixer
  • Pipettes (200 µl and 1000 µl)
  • Rack for Eppendorf tubes

Materials and reagents (per sample; storage conditions if not at room temperature):
  • 1.5 ml Eppendorf centrifuge tubes (2)
  • From Promega kit:
  • Proteinase K 600 U/mL (5 µl; freezer)*
  • Isopropanol (600 µl)
  • 70% ethanol (600 µl)
  • 1xTE buffer (100 µl; refrigerator)
  • Pipette tips: 1000 µl (3 per batch), 200 µl (1 per batch)

*Proteinase storage conditions may vary between products; follow the manufacturer's guidelines.
DNA extraction steps
Add 600 µL Nuclei Lysis Solution to each Eppendorf tube containing the homogenate (prepared according to Section 1: Sample homogenization).

Add 5 µL Proteinase K.

Vortex.
Incubate at 55 °C for 02:00:00 . If the thermoblock enables mixing, set at least 500 rpm. If mixing is not available, shake manually every 30 min.

2h
Cool to room temperature.
Add200 µL Protein Precipitation Solution.

Vortex or mix by shaking.
Put into freezer (-20 °C ) for 00:10:00 . Place also the alcohols (ethanol and isopropanol) in the freezer, to be cooled for further steps.
10m
Centrifuge for00:04:00 at maximum speed (14000 rpm ). In the meantime, prepare a new tube for each sample, label it accordingly (on the side and on the top of the tube), and add 600 µL of cooled isopropanol to each.

4m
Transfer the supernatant to the tubes with isopropanol (either by pouring or using a pipette). Discard the original tubes containing the pellet.

Mix by inverting. It can be done one by one or by covering the rack with samples with another empty rack and inverting 3 times. DNA can be visible as white threads. Sometimes the threads may not be visible, especially if the DNA concentration is low.
Centrifuge for 00:02:30 at 14000 rpm

2m 30s
Carefully discard the supernatant by decantation.
Add 600 µL of cooled ethanol and mix by inverting the tubes 2-3 times (as in Step 4.11.)

Centrifuge for00:02:30 at 14000 rpm

2m 30s
Carefully discard the supernatant. DNA should be visible as a white or transparent pellet.
Let the pellets air-dry for 01:00:00 at room temperature by placing inverted tubes on a paper towel (Figure 2.1.). Be careful not to prolong this step to avoid overdrying. Alternatively, remove any remaining liquid by careful aspiration with a pipette tip and leave the tubes open for 5 min.

Figure 2.1. Drying the DNA pellets after extraction.

1h
Add 100 µL 1xTE and mix with the pellet vigorously, e.g. by dragging the tubes along the rack (to detach the pellet from the tube wall).

Store in the refrigerator for at least 12 h ( Overnight ) before further steps. DNA samples can be kept for weeks to months in the refrigerator, for longer storage aliquot and freeze.

3. NanoDrop
Place: pre-PCR lab
Equipment:
  • NanoDrop
  • Pipettes (200 µl and 10 µl)
Materials and reagents:
  • DNA extracts
  • 200 µl and 10 µl pipette tips
  • TE buffer (the same as used to resuspend DNA pellets during extraction)
  • ddH2O
Measurement steps:
Clean the NanoDrop pedals with distilled water.
In the NanoDrop software, select the “Nucleic acid” measurement mode.
Perform blank measurements with 1 µL ddH2O and TE buffer as prompted.

Mix the DNA extracts by pipetting prior to measurement. Measure in 1 µL drops. Record the concentration as well as the 260/280 and 260/230 ratios.

Guidelines
  • Measure samples in duplicates.
  • Measurement for concentrations < 10 ng/µl is not accurate with NanoDrop.
  • DNA absorption is measured at 260 nm. The 260/280 and 260/230 ratios inform about extract purity:

- The 260/280 ratio informs about protein contamination. Optimal for DNA: 1.7-2.0 (Bio-rad guideline). If the ratio is too low, it indicates high amounts of protein relative to nucleic acid. Protein contamination can inhibit further reactions, e.g. PCR. Solution: increase the amount of proteinase K added in the digestion step, increase the incubation time.

- The 260/230 ratio informs about contamination with salts or other compounds (e.g. EDTA, phenol, guanidine hydrochloride). Optimal value: >1.5 (Bio-rad guideline). If low, clean the samples using spin columns or re-precipitation, add extra wash steps.
4. Standards preparation for qPCR calibration curve
2m
Purpose: For absolute quantification in qPCR, serial dilutions of a broader fragment of the N. ceranae Hsp70 gene than the target fragment are used to generate a standard curve, which is included on each plate alongside the test samples.

Description:
  • The reference Hsp70 sequence used for primer design in Primer Blast: was Nosema ceranae heat shock protein (AAJ76_4900027520), partial mRNA - Nucleotide - NCBI (nih.gov), accession no.: XM_024475769.1
  • The fragment amplified with the ‘Hsp70-broad’ primers spans positions 216-1039 in the reference sequence (while the target fragment corresponds to positions 498-562 in the reference). Primers were verified in silico using Primer Blast to exclude off-target amplification in Nosema ceranae or Apis mellifera, and analyzed in Multiple Primer Analyzer for secondary structures and other properties.
  • Experimental testing across an annealing temperature gradient of 52–56 °C showed consistent performance, and 56 °C was selected as the final annealing temperature.

Table 4.1. Primers for ‘broad’ Hsp70 fragment (qPCR standard)
GenePrimerPrimer sequence (5' - 3')TmProduct length (pos. in the reference sequence)
Hsp70 Hsp70_broad_F TGCGTCTAAGAGATTGCTGGG 56 °C 824 (216-1039)
Hsp70_broad_R GCATTCGTGTCATTCCACCC
1. Stage 1: pre-PCR

Place: pre-PCR lab

Equipment:
  • Thermocycler
  • Pipette (200 µl and 10 µl)

Materials and reagents:
Steps:
Prepare the PCR reaction in a larger total volume (5×; 125 µL in total) to obtain an excess of product, following the composition in Table 4.2. Place the reactTranion tubes in the thermocycler and run the program specified in Table 4.3.

Table 4.2. PCR mix:
reagent
DreamTaq Hot Start PCR Master Mix 12.5 μL 62.5 µl
Forward primer 10x 1 µl 5 µl
Reverse primer 10x 1 µl 5 µl
Template DNA 2 µl 10 µl
ddH20 8.5 µl 42.5 µl
Total volume 25 μL (23 µl mix + 2 µl DNA)
Table 4.3. PCR reaction steps:

steptemperaturestep durationrepeats
initialization 95 °C 3 min
denaturation 95 °C 30 s 40 ×
annealing56 °C (Hsp-broad) 30 s
elongation 72 °C 60 s
final elongation 72 °C 5 min
cooling 8 °C

After the program is finished, transfer the reaction tubes to post-PCR lab.
Stage 2: post-PCR 

Place:
All the remaining standard preparation steps will be performed in the post-PCR lab. Prepare the following equipment and materials:

Equipment:
  • Microwave 
  • Scale 
  • Agarose gel electrophoresis system (small) 
  • Electrophoresis combs (for big wells) 
  • Gel visualisation system
  • Incubator with mixing function
  • Pipettes (200 µl and 10 µl )
  • Centrifuge 
  • Qubit fluorometer

Materials and reagents: 
  • Pipette tips (200 µl and 10 µl)
  • Materials for agarose gel electrophoresis: TAE buffer, agarose, MidoriGreen, LoadingDye, Perfect 100-1000 DNA ladder 
  • Zymoclean™ Gel DNA Recovery KitZymo ResearchCatalog #D4001
  • 2 ml and 1.5 ml Eppendorf tubes 
  • Qubit tubes 
  • Qubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853
  • 'Broad' Hsp70 PCR product

Gel electrophoresis of the broad PCR product.  
Prepare 1.5% agarose gel: buffer: 30 ml, agarose: 0.45 g, MidoriGreen: 1.2 µl 
Distribute the whole PCR volume into two big wells, mixing with concentrated Loading Dye.
Load 3 µl of DNA ladder to a separate well and run the gel at 70 V for00:25:00 .
Purifying from gel using columns (ZymoClean Gel DNA Recovery Kit).
Follow the manufacturer's protocol (steps below):

All centrifugation steps should be performed at 10-16,000 g.
Cut the gel band (Figure 4.1.) and weight it in a 2 ml Eppendorf tube (tare the tube first).
Add ADB buffer (300 µl per 0.1 g of gel). 
Incubate at 55 °C with mixing for at least 10 min. 
Vortex. 
Transfer the mixture to the columns and centrifuge for 1 min. Discard the flow-through. 
Add 200 µl DNA Wash Buffer. 
Centrifuge for 30 s. Discard the flow-through. 
  Repeat steps 12.6-12.7.

Elution: Add water (for sequencing) or ≥6 µl of Elution Buffer (suggested: 15-30 µl). Place the column into a new 1.5 ml Eppendorf tube and centrifuge for 1 min.

If you plan to check the product by Sanger sequencing, use ddH₂O instead of Elution Buffer for the final elution. However, add TE buffer to the remaining stock that will not be used for sequencing, as it improves long-term stability.


Figure 4.1. PCR product incision from agarose gel. 

qPCR standard concentration measurement - Qubit fluorometer
Follow the manufacturer’s Instruction for the Qubit BroadRange (BR). Briefly:

Keep tubes and fthe working mix at room temperature (on the benchtop). Standards should be stored in the refrigerator.
Allow all the reagents to reach room temperature before use. 
Prepare two standards by adding to the two tubes: 190 µl mix + 10 µl of the appropraite standard solution.
Prepare the samples by adding to each tube: 198 µl mix + 2 µl sample.
Vortex and leave for 00:02:00 before measurement. 

2m
Follow the instrument's instructions: measure standards first, then the samples. Set appropriate sample volume and record the DNA concentration in the samples.
Calculate standard copy number per µl, following Qiagen equation:
qPCR standard dilution series
Prepare serial dilutions to obtain orders of magnitude from 108 to 10-1. The dynamic range of at least 5 concentrations is recommended (Qiagen). !!!Thorough mixing of the dilutions is essential for the accuracy of the standard curve!!!

Prepare only the amount of dilutions needed for immediate use (starting with 2 µl of the highest concentration) and keep the dilutions refrigerated. For long-term storage, keep the highest concentration in the freezer.
  • 2 µl of 1010 + 198 µl ddH2O → 10
  • 2 µl of 108 + 198 µl ddH2O → 10
  • 20 µl of 106 + 180 µl ddH2O → 10
  • 20 µl of 105 + 180 µl ddH2O → 10
  • 20 µl of 104 + 180 µl ddH2O → 10
  • 20 µl of 103 + 180 µl ddH2O → 102 
  • 20 µl of 102 + 180 µl ddH2O → 10
  • 20 µl of 101 + 180 µl ddH2O → 10
  • 20 µl of 100 + 180 µl ddH2O → 10-1 

5. qPCR
1. Stage 1: pre-PCR

Place: pre-PCR lab 
Equipment: pipettes:
  • multi-channel for 20 µl and 5 µl
  • 1000 µl
  • 100 µl
Materials and reagents: 
  • qPCR plates (BioRad) 
  • qPCR plate seal (BioRad) 
  • SYBR Green (BioRad SsoAdvanced Universal SYBR Green Supermix) 
  • Primers: Hsp70_F and Hsp70_R (Table 5.1), 0.2 µM final concentration each (0.8 µl of primers stock diluted 20× to 5 µM) 
  • ddH2
  • pipette tips : 1000 µl, 1000 µl, 10 µl
  • DNA extracts prepared in Section 2: DNA extraction.
  • Box with ice.
Table 5.1 Hsp70 primer sequences. Reference: Cilia et al. 2018 
GenePrimerPrimer sequence (5' - 3')Product length (pos. in the reference sequence)
Hsp70 Hsp70_F GGGATTACAAGTGCTTAGAGTGATT 65 bp (498-562)
Hsp70_R TGTCAAGCCCATAAGCAAGTG 

 
Prepare plate layout, including  wells for standards (8 concentrations in 3 replicates each = 24), extraction blank, non-template control (NTC), tested samples in duplicates or triplicates. Example plate layout: Figure 5.1. 


12345
A
Std1
Std1
Std1
Unk1
Unk1
B
Std2
Std2
Std2
Unk2
Unk2
C
Std3
Std3
Std3
Unk3
Unk3
D
Std4
Std4
Std4
Unk4
Unk4
E
Std5
Std5
Std5
Unk5
Unk5
F
Std6
Std6
Std6
Unk6
Unk6
G
Std7
Std7
Std7
Unk7
Unk7
H
Std8
Std8
Std8
Unk8
Unk8
678910
A
Unk1
Unk9
Unk9
Unk9
Neg1
B
Unk2
Unk10
Unk10
Unk10
Unk17
C
Unk3
Unk11
Unk11
Unk11
Unk18
D
Unk4
Unk12
Unk12
Unk12
Unk19
E
Unk5
Unk13
Unk13
Unk13
Unk20
F
Unk6
Unk14
Unk14
Unk14
Unk21
G
Unk7
Unk15
Unk15
Unk15
Unk22
H
Unk8
Unk16
Unk16
Unk16
NTC
1112
A
Neg1
Neg1
B
Unk17
Unk17
C
Unk18
Unk18
D
Unk19
Unk19
E
Unk20
Unk20
F
Unk21
Unk21
G
Unk22
Unk22
H
NTC
NTC
Figure 5.1. Example qPCR plate layout. Std – standards, Unk – tested samples, Neg – extraction blank, NTC – non-template control (qPCR blank) 
Dilute 5 µl of each DNA extract 10× with ddH2O.

Calculate the number of wells on the plate that will be used (based on the example in Table 5.2).

Table 5.2. Calculation of the number of wells on the plate and the amount of mix required (example: 7 samples and 7 standards, each in triplicate). The total volume of mix should be prepared with a 15% excess to prevent volume loss due to pipetting.
Sample categoryNumber of samplesNumber of replicatesNumber of samples × number of repliactesTotal numer of well platesTotal + 15%
Unknown sample73214552
Standard7321
Blank133

Prepare the qPCR mix On ice , according to Table 5.3.

Table 5.3. qPCR mix preparation (for the number of samples calculated in Step 15.3, Table 5.2.).
Mix (µl)52×
SYBR Green10520
Hsp70_F primer 20x0.841.6
Hsp70_R primer 20x0.841.6
ddH2O3.4176.8
  • To each well 15 µl of mix and 5 µl of DNA should be added.
Distribute 15 µl of reaction mix to each well on the qPCR plate On ice

Add 5 µl of the diluted DNA extracts to each well in duplicates or triplicates, according to the plate layout.
Mix them well before adding.
Standards will be added later, in post-PCR room. 
Seal the plate (except for the rows designated for standards) and move to post-PCR lab.
2. Stage 2 - post-PCR

Place: post-PCR lab 
Equipment:
  • Thermocycler: Bio-Rad CFX 96 Touch (CFX96 Touch Real-Time PCR Detection System) 
  • Computer with BioRad CFX Maestro Software 
  • Multi-channel pipette for 5 µl
  • Centrifuge for PCR plates 
Materials and reagents: 
  • Pipette tips (5 µl)
  • Standards (prepared and diluted as in Section 4) 
  • Reaction plate from previous step. 
Connect the thermocycler to the computer running BioRad CFX Maestro Software. Prepare the plate layout, marking the well categories and replicates. Enter the standards concentrations (in copies/µl, as calculated in Section 4). Program the cycling protocol as shown in Table 5.4.
Table 5.4. qPCR program.
temperaturedurationrepeats
98 °C 3 min  
98 °C 15 s 40×
60 °C  30 s  
melting curve
65-95 °C in 0.5 °C increments5 s/ step

Add standards to the appropriate wells on the qPCR plate, covering the range from 106 copies/µl (Std1) to 10-1 copies/µl (Std8), in a 10× dilution series, in three replicates. 
Seal the plate and centrifuge shortly.
Place the plate in the thermocycler and start the program. 
After the protocol is finished, analyse its parameters: 

  • Melting curve should form a single peak. More peaks indicate possible off-target products of primer-dimers formation. 
  • The difference between technical replicates should not exceed 1 Cq (Mura et al. 2020). 
  • PCR efficiency should fall within the range 90-110 (slope -3,58 – (-3.10); Applied Biosystems Real-Time PCR handbook) 
  • Standard curve should be linear (R2 > 0.98; BioRad guidelines). 
  • Wells with results outside the accepted quality range can be excluded from analysis.  
  • The desired Cq difference between negative and positive samples should be ≥10. 
  • No amplification should be detected in the NTC samples. 
  • If some of the parameters do not meet the desired criteria, refer to the protocol's Troubleshooting section.
Based on the Mean quantity in the analysed samples, calculated by the software based on a melting curve, calculate the number of spores per bee: 

N Hsp70 (molecules/µl) × 1 (1 Hsp70 copy per spore) × 100 µl (total DNA extract volume) × 10 (DNA extract dilution) × 4 (as 1/4 of homogenate volume was taken to DNA extraction) = N Hsp70 (molecules/µl) × 4000 
Protocol references
Promega extraction kit protocol:

ZymoClean Gel DNA Recovery Kit protocol:

Qubit dsDNA BR Assay Kit User Guide:

AppliedBiosystems Real Time PCR handbook:

Qiagen: Absolute Quantification qPCR vs Relative Quantification qPCR

Hsp70 primers source: Cilia, G. et al. (2018) “A novel TaqMan assay for Nosema ceranae quantification in honey bee, based on the protein coding gene Hsp70,” European Journal of Protistology, 63, pp. 44–50. Available at: https://doi.org/10.1016/j.ejop.2018.01.007.

Mura, A. et al. (2020) “Propolis Consumption Reduces Nosema ceranae Infection of European Honey Bees (Apis mellifera),” Insects, 11(2), p. 124. Available at: https://doi.org/10.3390/insects11020124.
Acknowledgements
The authors thank the following contributors:

- Dr. Katarzyna Dudek and Dr. Magdalena Migalska (Institute of Environmental Sciences, Jagiellonian University) for consultations and advice during protocol design and optimization.

- Dr. Daniel Stec, MSc Bartłomiej Surmacz, and Dr. Krzysztof Miler (Institute of Systematics and Evolution of Animals, Polish Academy of Sciences), for valuable comments improving the initial version of the protocol.