May 20, 2020
A rapid, sensitive, scalable method for Precision Run-On sequencing (qPRO-seq)
- Julius Judd1,2,
- Luke A. Wojenski3,2,
- Lauren M. Wainman3,2,
- Nathaniel D. Tippens1,
- Edward J. Rice4,
- Alexis Dziubek3,1,
- Geno J. Villafano3,
- Erin M. Wissink1,
- Philip Versluis1,
- Lina Bagepalli1,
- Sagar R. Shah1,
- Dig B. Mahat1,
- Jacob M. Tome1,
- Charles G. Danko4,5,
- John T. Lis1,
- Leighton J. Core1,3
- 1Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14835, USA;
- 2Authors Contributed Equally;
- 3Department of Molecular and Cell Biology, Institute of Systems Genomics, University of Connecticut, Storrs, CT 06269, USA;
- 4Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA;
- 5Department of Biomedical Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA
Protocol Citation: Julius Judd, Luke A. Wojenski, Lauren M. Wainman, Nathaniel D. Tippens, Edward J. Rice, Alexis Dziubek, Geno J. Villafano, Erin M. Wissink, Philip Versluis, Lina Bagepalli, Sagar R. Shah, Dig B. Mahat, Jacob M. Tome, Charles G. Danko, John T. Lis, Leighton J. Core 2020. A rapid, sensitive, scalable method for Precision Run-On sequencing (qPRO-seq). protocols.io https://dx.doi.org/10.17504/protocols.io.57dg9i6
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 06, 2019
Last Modified: December 12, 2020
Protocol Integer ID: 26565
Materials
MATERIALS
ThermoPol Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9004S
T4 RNA Ligase 1 (ssRNA Ligase) - 5,000 unitsNew England BiolabsCatalog #M0204L
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
Q5 High-Fidelity DNA Polymerase - 100 unitsNew England BiolabsCatalog #M0491S
SYBR Gold Nucleic Acid Gel StainCatalog # S-11494
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Magnesium ChlorideFisher ScientificCatalog #AC223210010
TRIzol ReagentThermo Fisher ScientificCatalog #15596026
EGTAMerck MilliporeSigma (Sigma-Aldrich)
Superase-In RNase InhibitorThermofisherCatalog #AM2694
sarkosylMerck MilliporeSigma (Sigma-Aldrich)Catalog #L5777
SucroseMerck MilliporeSigma (Sigma-Aldrich)Catalog #S7903
Diethyl pyrocarbonateMerck MilliporeSigma (Sigma-Aldrich)Catalog #D5758
ChloroformMerck MilliporeSigma (Sigma-Aldrich)Catalog #319988
Sodium hydroxideMerck MilliporeSigma (Sigma-Aldrich)Catalog #S8045
Potassium ChlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #P9541
GlycerolThermo Fisher ScientificCatalog #17904
Dynabeads MyOne Streptavidin C1Invitrogen - Thermo FisherCatalog #65001
Dithiothreitol (DTT)Thermo Fisher ScientificCatalog #707265ML
Tris BaseFisher ScientificCatalog #BP152
T4 Polynucleotide KinaseNew England BiolabsCatalog #M0201S
Triton X-100Fisher ScientificCatalog #BP151-100
Tween-20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416
Sodium chlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #S3014
EthanolMerck Millipore (EMD Millipore)Catalog #100983
TRIzol™ LS ReagentThermo FisherCatalog #10296028
EDTAThermo FisherCatalog #17892
ATPThermo FisherCatalog #18330019
GTPThermo FisherCatalog #18332015
Pierce Protease Inhibitor TabletsThermo FisherCatalog #A32963
GlycoBlue™ Coprecipitant (15 mg/mL)Thermo FisherCatalog #AM9515
DEPC-Treated WaterThermo FisherCatalog #AM9920
Maxima H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0753
IGEPAL® CA-630 Merck MilliporeSigma (Sigma-Aldrich)Catalog #I8896
SsoAdvanced Universal SYBR® Green SupermixBio-Rad LaboratoriesCatalog #172-5270
Trypan BlueMerck MilliporeSigma (Sigma-Aldrich)Catalog #T8154
Biotin-11-CTPPerkin ElmerCatalog #NEL542001EA
Biotin-11-UTPPerkin ElmerCatalog #NEL543001EA
Biotin-11-GTPPerkin ElmerCatalog #NEL545001EA
Biotin-11-ATPPerkin ElmerCatalog #NEL544001EA
Total RNA Purification KitNorgen Biotek Corp.Catalog #37500
dNTP mix 12.5 mM eachRocheCatalog #03622614001
Micro Bio-Spin RNase free P-30 Gel ColumnsBio-Rad LaboratoriesCatalog #7326250
Costar Spin-X 0.22 um Centrifuge Tube FiltersCorningCatalog #1860
REV3 Adapter /5Phos/rUrNrNrNrNrNNGATCGTCGGACTGTAGAACTCTGAAC/3InvdT/ RNase-free HPLCIDT
REV5 adapter /5InvddT/CCTTGGCACCCGAGAATTCCANrNrNrNrNrNrC RNase-free HPLCIDT
Primer RP1 AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA PAGE-purifiedIDT
Primer RPI-1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-2 CAAGCAGAAGACGGCATACGAGATAGATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-4 CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-7 CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purified
Primer RPI-8 CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-9 CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-10 CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-11 CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Primer RPI-12 CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA PAGE-purifiedIDT
Cell Permeabilization
Cell Permeabilization
1h 30m
1h 30m
Prepare permeabilization buffer, wash buffer, and freeze buffer and place On ice .
Safety information
CAUTION: DEPC is toxic and harmful!
Safety information
CRITICAL: Care should be taken to avoid nuclease contamination. Change gloves routinely and prepare/use nuclease-free reagents.
Safety information
CRITICAL: ALL steps should be carried out on ice or in a cold room
Note
All salt solutions should be prepared in ddH2O. Then add 0.1% (v/v) DEPC, stir overnight, and autoclave. Tris buffers instead need to be carefully prepared with DEPC-treated ddH2O.
Note
All other solutions (detergents, DTT, sucrose, EDTA/EGTA, and Tris buffers) should be prepared in DEPC ddH2O in RNase free containers and filter sterilized. Glassware can be made RNase by filling with water, adding 0.1% (v/v) DEPC, incubating with agitation overnight, and autoclaving. Alternatively, glassware can be baked at 300 °C for 4 hours.
Note
The permeabilization buffer, cell wash buffer, freeze buffer, and bead washing/binding buffers can be made and filter-sterilized in advance without the DTT, SUPERase-In™ RNase Inhibitor, and Pierce™ protease inhibitor tablets. DTT, SUPERase-In™ RNase Inhibitor, and protease inhibitor tablets can be added when buffers are needed. Store buffers at 4°C. Use DEPC treated glassware or RNase free plasticware.
Permeabilization Buffer:
10 millimolar (mM) Tris-Cl, pH 8.0
10 millimolar (mM) KCl
250 millimolar (mM) Sucrose
5 millimolar (mM) MgCl2
1 millimolar (mM) EGTA
0.1 % (v/v) Igepal
0.5 millimolar (mM) DTT
0.05 % (v/v) Tween-20
10 % (v/v) Glycerol
in DEPC-treated ddH2O.
Add 1 Pierce protease inhibitor tablet and 10 µL SUPERase-In RNase inhibitor per 50 mL .
Cell Wash buffer:
10 millimolar (mM) Tris-Cl, pH 8.0
10 millimolar (mM) KCl
250 millimolar (mM) sucrose
5 millimolar (mM) MgCl2
1 millimolar (mM) EGTA
0.5 millimolar (mM) DTT
10 % (v/v) Glycerol
in DEPC-treated ddH2O.
Add 1 Pierce protease Inhibitor tablet and 10 µL SUPERase-In RNase inhibitor per 50 mL .
Freeze buffer:
50 millimolar (mM) Tris-Cl, pH 8.0
40 % (v/v) glycerol
5 millimolar (mM) MgCl2
1.1 millimolar (mM) EDTA
0.5 millimolar (mM) DTT
in DEPC-treated ddH2O.
Add 10 µL SUPERase-In RNase inhibitor per 50 mL .
Proceed using one of the following options:
Option 2.1.: Adherent cells (volumes are for 10 cm plates):
2.1.1. Wash cells with 10 mL ice cold PBS.
2.1.2. Repeat the PBS wash step for a total of two washes.
2.1.3. Add 5 mL ice cold permeabilization buffer, scrape cells, and transfer to a conical tube.
2.1.4. Rinse plate with 5 mL permeabilization buffer and pool cells in conical tube (Vf = 10 mL ).
Option 2.2: Suspension cells:
2.2.1. Transfer cells into conical tubes and spin down at 700–1000 x g for 00:04:00 at 4 °C .
2.2.2. Wash with 10 mL ice cold PBS.
2.2.3. Repeat the PBS wash for a total of two washes.
2.2.4. Resuspend in 10 mL cold permeabilization buffer.
Note
Use a centrifuge with a swinging bucket rotor for all centrifuge steps during cell permeabilization. Using a fixed angle rotor will shear cells, releasing a smear of white chromatin.
Note
Centrifuge speed is cell size dependent. We typically centrifuge HeLa at 800 x g and Drosophila at 1,000 x g.
Note
When resuspending cells during permeabilization after centrifugation steps, first gently resuspend the cell pellet with 1 mL solution with a wide-bore P1000 tip. Then add the remaining volume (usually 9 mL) and mix by gentle inversion.
Incubate on ice for 00:05:00 .
Check for permeabilization with Trypan blue. Greater than 98% permeabilization is ideal.
Note
If your cell type is not permeabilized under these conditions, add Triton X-100 to 0.1 % (v/v) —0.2 % (v/v) .
Spin down at 700–1000 x g for 00:04:00 at 4 °C .
Note
Centrifuge speed is cell size dependent. We typically centrifuge HeLa at 800 x g and Drosophila at 1,000 x g.
Wash with 10 mL ice cold cell wash buffer.
Note
When resuspending cells during permeabilization after centrifugation steps, first gently resuspend the cell pellet with 1 mL solution with a wide-bore P1000 tip. Then add the remaining volume (usually 9 mL) and mix by gentle inversion.
Repeat the cell wash buffer wash for a total of two washes.
Decant wash buffer, and then carefully pipette off remaining buffer and discard without disturbing the cell pellet.
Using wide-bore tips, resuspend in 250 µL cold freeze buffer and transfer to a 1.5 mL tube.
Rinse the conical tube with an additional 250 µL freeze buffer and pool (Vf = 500 µL ).
Count cells and add permeabilized spike-in cells if desired.
Note
When processing multiple samples, if counting will cause the cells to sit on ice for greater than 10 min, reserve 10 µL for counting, aliquot cells in 100 µL aliquots, and snap freeze. Count the cells and then adjust the concentration with freeze buffer after thawing and prior to the run-on.
Note
In order to robustly normalize between conditions where a dramatic change in global transcription levels are expected, we add a fixed number of cells of a different species to a fixed number of experimental cells at the permeabilization step. Reads can be mapped to a combined genome, and the number of spike-in mapped reads can then be used as a scaling factor. These cells should be permeabilized prior to the experiment, aliquoted, and added to 1-2% by cell number after permeabilization and counting, either just prior to freezing or just prior to the run-on reaction. We frequently use Drosophila S2 cells to normalize human cell experiments and vice versa.
Spin down at 1000 x g for 00:05:00 at 4 °C .
Note
Microfuge tubes can be spun in a fixed angle rotor, but we continue to use a swinging bucket rotor so that cells collect at bottom of tube (this tends to decrease cell loss).
Resuspend the desired number of cells for each run-on reaction in 52 µL freeze buffer.
Note
We have had success performing this protocol with as few as 50k primary human cells. In general, we find that the quality of libraries will increase until ~1 x 106 cells per run-on but using more cells than this offers little benefit. This will also depend on how transcriptionally active a given cell type is and genome size.
Continue to the run-on or snap freeze 52 µL aliquots in LN2 and store at -80 °C .
Note
Permeabilized cells are stable indefinitely at -80°C (Chu et al., 2018).
Preparation for the Run-On
Preparation for the Run-On
30m
30m
Pre-chill a microcentrifuge to 4 °C .
Set a heat block with water in the wells to 37 °C and another to 65 °C and allow temperature to equilibrate.
Note
A thermomixer set to 37 °C can also be used for incubating the run-on reactions.
Prepare bead preparation buffer, high salt wash buffer, low salt wash buffer, and binding buffer, and store On ice
Note
The permeabilization buffer, cell wash buffer, freeze buffer, and bead washing/binding buffers can be made and filter-sterilized in advance without the DTT, SUPERase-In™ RNase Inhibitor, and Pierce™ protease inhibitor tablets. DTT, SUPERase-In™ RNase Inhibitor, and protease inhibitor tablets can be added when buffers are needed. Store buffers at 4°C. Use DEPC treated glassware or RNase free plasticware.
Bead Preparation Buffer:
0.1 Molarity (M) NaOH
50 millimolar (mM) NaCl
in DEPC-treated ddH2O.
Bead Binding Buffer:
10 millimolar (mM) Tris-HCl, pH 7.4
300 millimolar (mM) NaCl
0.1 % (v/v) Triton X-100
1 millimolar (mM) EDTA
in DEPC-treated ddH2O.
Add 2 µL SUPERase-In RNase Inhibitor per 10 mL .
High Salt Wash buffer:
50 millimolar (mM) Tris-HCl, pH 7.4
2 Molarity (M) NaCl
0.5 % (v/v) Triton X-100
1 millimolar (mM) EDTA
in DEPC-treat H2O.
Add 2 µL SUPERase-In RNase Inhibitor per 10 mL .
Low Salt Wash Buffer:
5 millimolar (mM) Tris-HCl, pH 7.4
0.1 % (v/v) Triton X-100
1 millimolar (mM) EDTA
in DEPC-treated ddH2O.
Add 2 µL SUPERase-In RNase Inhibitor per 10 mL .
For each run-on reaction, wash 10 µL Dynabeads™ MyOne™ Streptavidin C1 Beads once in 1 mL bead preparation buffer using a magnet stand. Beads can be washed in bulk.
Safety information
CRITICAL:Be sure to properly resuspend beads prior to aliquoting them.
Note
C1 Streptavidin beads are preferred compared to M280 beads because they have higher binding capacity and use a negatively charged matrix. This significantly reduces carryover of non-biotinylated RNAs including adapter dimers.
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Wash beads twice with 1 mL binding buffer.
Note
Always quickly spin samples down using a picofuge to remove liquid from tube caps between washes.
Resuspend the beads in 25 µL binding buffer per sample. Place beads On ice or at 4 °C until needed.
Run-On Reaction
Run-On Reaction
30m
30m
Prepare 2XROMM equilibrate at 37 °C (30 °C for Drosophila).
Note
When preparing the 2XROMM, first add all components other than Sarkosyl and mix by vortexing on high for >10 sec. Collect the solution with a quick spin, add Sarkosyl, and mix thoroughly by pipetting carefully to avoid bubbles. If you leave the 2XROMM on ice, a precipitate can form. Before use, check if this has occurred. The precipitate can be re-dissolved by heating at 37 °C for ~5 min and pipette mixing.
2X Run-On Master Mix (2XROMM):
10 millimolar (mM) Tris-Cl, pH 8.0
5 millimolar (mM) MgCl2
1 millimolar (mM) DTT
300 millimolar (mM) KCl
40 micromolar (µM) Biotin-11-CTP
40 micromolar (µM) Biotin-11-UTP
40 micromolar (µM) Biotin-11-ATP
40 micromolar (µM) Biotin-11-GTP
1 Mass Percent Sarkosyl
in DEPC-treated ddH2O
Add 1 µL SUPERase-In RNase Inhibitor per reaction.
Note
The run-on reaction uses 4 biotin-NTPs. However, ATP and GTP can be substituted at equal concentration for Biotin-11-ATP and Biotin-11-GTP to reduce cost. Biotin-11-ATP and biotin-11-GTP are 10X as expensive as biotin-11-CTP and biotin-11-UTP. With two biotin-NTPs blocking elongation, each polymerase can be expected to extend ~5 nt or less which we find gives sufficient resolution for the vast majority of applications. For low cell number experiments, increase the concentration of the biotin-NTPs to 500 µM. Biotin-NTP incorporation efficiency is ~60% with the concentration in the 2XROMM as written, which is sufficient for experiments using 106cells or greater, but increasing the concentration improves incorporation to ~77%.
Using a wide bore tip, add 50 µL of permeabilized cells to new 1.5 mL tube.
Pipette 50 µL of preheated 2XROMM into each reaction tube (already containing permeabilized cells). Gently and thoroughly pipette the mixture 15 times.
Safety information
It is extremely important to thoroughly mix the reaction so that nucleotides diffuse into highly viscous chromatin!
Incubate in a heat block or thermomixer at 37 °C (30 °C for Drosophila) at 750 RPM for 00:05:00 . Have RL buffer from Norgen kit or TRIzol LS ready for use.
Proceed to step 26.1 or 26.2 depending on choice of RNA extraction method immediately after the 00:05:00 reaction is complete (take the sample off the heat block and immediately add buffer RL or TRIzol LS).
Note
Stagger both addition of the 2XROMM and addition of TRIzol or buffer RL by 30 seconds or 1 minute, to ensure each sample is incubated exactly 5 min.
Total RNA extraction and Base Hydrolysis
Total RNA extraction and Base Hydrolysis
1h 30m
1h 30m
Proceed from Step 25 to one of the following options:
Note
TRIzol LS or the Norgen Total RNA Purification Kit can be used to extract total RNA from the run-on reaction. Both options produce identical results. The Norgen kit is faster and less technically challenging to use, but more expensive. If TRIzol LS is used, Micro Bio-Spin™ RNase free P-30 Gel Columns are also needed to remove unincorporated biotin-NTPs as the biotin concentration will otherwise overwhelm the binding capacity of the streptavidin beads.
Option 26.1: NORGEN RNA Extraction:
1. Add 350 µL RL buffer and vortex.
2. Add 240 µL 100 % (v/v) ethanol and vortex.
3. Apply solution to Norgen RNA extraction column.
4. Spin at 3,500 x g for 00:01:00 at 25 °C .
5. Add 400 µL wash solution A (ensure ethanol has been added).
6. Spin at 14,000 x g for 00:01:00 at 25 °C .
7. Discard flow through.
8. Repeat wash (steps 6 & 7) for a total of two washes.
9. Spin at 14,000 x g for 00:02:00 to dry column.
10. Add 50 µL DEPC-treated ddH2O and vortex.
11. Elute by spinning at 200 x g for 00:02:00 at 25 °C and then at 14,000 x g for 00:01:00 at 25 °C .
12. Elute again with 50 µL DEPC-treated ddH2O and pool eluates (Vf = 100 µL ).
13. Denature at 65 °C for 00:00:30 and then snap cool on ice.
14. Add 25 µL ice cold 1 Molarity (M) NaOH and incubate 00:10:00 on ice.
15. Add 125 µL cold 1 Molarity (M) Tris-Cl pH 6.8, mix by pipetting.
16. Add 5 µL 5 Molarity (M) NaCl and 1 µL GlycoBlue and mix.
17. Add 625 µL 100 % (v/v) Ethanol and vortex.
Note
If the protocol needs to be performed over two days, the ethanol precipitation in step 26.1.17 is the safest overnight stopping point. Store samples at -80 °C.
18. Centrifuge the samples at >20,000 x g for 00:20:00 at 4 °C .
Note
A blue pellet should be visible at the bottom of tube. The pellet can be difficult to see but should be visible. It may appear spread out. If a pellet is not visible, vortex well and repeat spin.
19. Carefully pipette supernatant off and discard.
Note
When removing the supernatant before the 70% ethanol wash be careful not to disturb the pellet. Approximately 30–50μL of ethanol can be left in the tube to avoid disturbing the pellet prior to adding the 70% ethanol wash. This procedure can also be used after the 70% ethanol wash (step 25.1.22), but then remove the final 30-50 µL using a P200 tip after a quick spin in a picofuge.
20. Add 750 µL 70 % (v/v) ethanol.
21. Mix by gentle inversion and spin down briefly.
22. Carefully pipette supernatant off and discard.
23. Airdry the RNA pellet.
Note
Air dry the RNA pellet by leaving tubes open in fume hood to prevent contamination. This will take ~3-10 min depending on how much ethanol is left in the tube. Do not to let the RNA pellet dry completely as this will greatly decrease its solubility.
24. Resuspend in 6 µL DEPC-treated ddH2O.
Option 26.2: Trizol LS RNA Extraction:
1. Add 250 µL TRIzol LS with a wide bore P1000 tip and carefully pipette >10X until all white globs of nucleoproteins are homogenized.
2. Pipette mix again with a standard bore P1000 tip. Samples should be completely homogenous.
3. Vortex vigorously for at least 00:00:15 .
4. Incubate samples on ice until all run-on reactions are complete.
5. Add 65 µL chloroform.
Note
When pipetting chloroform, always pipette twice because the first draw always leaks.
6. Vortex the samples at max speed for 00:00:15 , then incubate on ice for 00:03:00 .
7. Centrifuge the samples at >20,000 x g for 00:08:00 at 4 °C .
8. Transfer the ~200 µL aqueous phase into a new tube.
Note
When transferring the aqueous phase of TRIzol extractions to a new tube, tilt the tube to a 45° angle and carefully remove only the clear liquid. Avoid contamination by the pink organic phase or white interphase.
9. Add 1 µL of GlycoBlue and mix.
10. Add 2.5X volumes (~500 µL ) 100 % (v/v) ethanol and vortex.
11. Centrifuge at > 20,000 x g for 00:20:00 at 4 °C .
Note
A blue pellet should be visible at the bottom of tube. The pellet can be difficult to see but should be visible. It may appear spread out. If a pellet is not visible, vortex well and repeat spin.
12. Carefully pipette supernatant off and discard.
Note
When removing the supernatant before the 70% ethanol wash be careful not to disturb the pellet. Approximately 30–50μL of ethanol can be left in the tube to avoid disturbing the pellet prior to adding the 70% ethanol wash. This procedure can also be used after the 70% ethanol wash (step 26.2.15), but then remove the final 30-50 µL using a P200 tip after a quick spin in a picofuge.
13. Add 750 µL 70 % (v/v) ethanol.
14. Mix by gentle inversion and quickly spin down.
15. Carefully pipette supernatant off and discard.
16. Airdry the RNA pellet.
Note
Air dry the RNA pellet by leaving tubes open in fume hood to prevent contamination. This will take ~3-10 min depending on how much ethanol is left in the tube. Do not to let the RNA pellet dry completely as this will greatly decrease its solubility.
17. Resuspend in 30 µL DEPC-treated ddH2O.
18. Briefly denature at 65 °C for 00:00:30 and then snap cool On ice .
19. Add 7.5 µL ice cold 1 Molarity (M) NaOH and incubate On ice for 00:10:00 .
20. Add 37.5 µL 1 Molarity (M) Tris-Cl 6.8 , mix by pipetting.
21. Pass through a calibrated Bio-Rad RNase free P-30 column (follow manufacturer’s instructions).
22. Bring volume to 200 µL with DEPC-treated ddH2O (add ~ 125 µL ).
23. Add 1 µL Glycoblue and 8 µL 5 Molarity (M) NaCl and vortex.
24. Add 500 µL 100 % (v/v) ethanol and vortex.
Note
If the protocol needs to be performed over two days, the ethanol precipitation in 26.2.24 is the safest overnight stopping point. Store samples at -80 °C.
25. Centrifuge at >20,000 x g for 00:20:00 at 4 °C .
Note
A blue pellet should be visible at the bottom of tube. The pellet can be difficult to see but should be visible. It may appear spread out. If a pellet is not visible, vortex well and repeat spin.
26. Carefully pipette supernatant off and discard.
Note
When removing the supernatant before the 70% ethanol wash be careful not to disturb the pellet. Approximately 30–50μL of ethanol can be left in the tube to avoid disturbing the pellet prior to adding the 70% ethanol wash. This procedure can also be used after the 70% ethanol wash (step 26.2.29), but then remove the final 30-50 µL using a P200 tip after a quick spin in a picofuge.
27. Add 750 µL 70 % (v/v) ethanol.
28. Mix by gentle inversion and quickly spin down.
29. Carefully pipette supernatant off and discard.
30. Airdry the RNA pellet.
Note
Air dry the RNA pellet by leaving tubes open in fume hood to prevent contamination. This will take ~3-10 min depending on how much ethanol is left in the tube. Do not to let the RNA pellet dry completely as this will greatly decrease its solubility.
31. Resuspend in 6 µL DEPC-treated ddH2O.
3'RNA Adapter Ligation
3'RNA Adapter Ligation
1h 15m
1h 15m
Continue here from step 26.1.24 or 26.2.31:
Add 1 µL 10 micromolar (µM) VRA3 (Vf = 7 µL ).
Note
The concentration of RNA adapters in the ligation steps (1 µL 10 µM) is optimal for approximately 106 mammalian cells. For lower cell numbers, the adapter concentration must be diluted to limit dimer formation. We dilute linearly with cell concentration relative to this established concentration, i.e. 1 µL 5 µM for 5 x 105 cells, 1 µL 2.5 µM for 2.5 x 105 cells, etc.
Denature at 65 °C for 00:00:30 and snap cool On ice .
Prepare ligation mix in the following order:
| Reagent | Volume | |
| 10X T4 RNA Ligase Buffer | 2 µL | |
| ATP (10 mM) | 2 µL | |
| SUPERase-In RNase Inhibitor | 1 µL | |
| 50% PEG8000 | 6 µL | |
| T4 RNA LIgase 1 (ssRNA ligase) | 2 µL |
Note
Pipette slowly because 50% PEG8000 is very viscous. Heating 50% PEG8000 makes it easier to pipette. Pipette the ligation mix until it is homogenous before use.
Note
When preparing enzymatic reaction mixtures that contain SUPERase-In RNase Inhibitor, a fixed volume (1 µL) SUPERase-In can be added to the entire master mix regardless of number of reactions to decrease cost. Bring the remainder of the master mix up to the required volume with DEPC-treated ddH2O. Murine RNase inhibitor can also be substituted to limit costs for all steps after the run-on. SUPERase-In is recommended prior to the run-on as it inhibits T1 RNase.
Add 13 µL and mix by pipetting 10–15X (Vf = 20 µL ).
Incubate at25 °C for 01:00:00 .
Streptavidin Bead Binding
Streptavidin Bead Binding
45m
45m
Add 55 µL binding buffer to each sample (Vf = 75 µL ).
Add 25 µL pre-washed beads to each sample (Vf = 100 µL ).
Incubate for 00:20:00 at 25 °C with end to end rotation.
Wash once with 500 µL High Salt Wash buffer with tube swap.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
For each washing step gently invert tubes 10–15X, quickly spin down with a picofuge, open caps, and then place on the magnet stand. Wait 1-2 minutes and pipette the supernatant off without disturbing the beads. If there are bubbles in the tube carefully pipette them off first and then remove supernatant. Beware that bubbles may dislodge beads from the side of the tube. After removing the bulk of the liquid, collect remaining liquid with a quick spin in a picofuge, place the tube back on the magnet stand, and carefully remove remaining liquid by pipetting.
Note
Transferring beads to a new tube after the binding incubation—during the high salt wash step—helps limit adapter dimer formation. After resuspending the beads in High Salt buffer, quickly spin down with a picofuge, resuspend beads by gently pipetting, and carefully transfer to a new tube. Pipette slowly to avoid bead loss! Place this new tube on the magnet stand and proceed with the washing protocol.
Wash once with 500 µL Low Salt Wash buffer.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
For each washing step gently invert tubes 10–15X, quickly spin down with a picofuge, open caps, and then place on the magnet stand. Wait 1-2 minutes and pipette the supernatant off without disturbing the beads. If there are bubbles in the tube carefully pipette them off first and then remove supernatant. Beware that bubbles may dislodge beads from the side of the tube. After removing the bulk of the liquid, collect remaining liquid with a quick spin in a picofuge, place the tube back on the magnet stand, and carefully remove remaining liquid by pipetting.
Note
Do not allow streptavidin beads to dry completely, as this can lead to clumping and make full resuspension impossible. When processing multiple samples, remove liquid from the previous wash or enzymatic step from the first sample and immediately resuspend those beads in the next solution, then repeat this process for additional samples.
On-Bead 5’ Hydroxyl Repair
On-Bead 5’ Hydroxyl Repair
45m
45m
Resuspend beads in 19 µL PNK mix (Vf = 20 µL :
| Reagent | Volume | |
| DEPC-treated ddH2O | 13 µL | |
| 10X PNK buffer | 2 µL | |
| 10 mM ATP | 2 µL | |
| T4 Polynucleotice Kinase | 1 µL | |
| SUPERase-In RNase Inhibitor | 1 µL |
Note
On-bead reaction volumes assume that 1 µL of liquid remains on the beads.
Note
When preparing enzymatic reaction mixtures that contain SUPERase-In RNase Inhibitor, a fixed volume (1 µL) SUPERase-In can be added to the entire master mix regardless of number of reactions to decrease cost. Bring the remainder of the master mix up to the required volume with DEPC-treated ddH2O. Murine RNase inhibitor can also be substituted to limit costs for all steps after the run-on. SUPERase-In is recommended prior to the run-on as it inhibits T1 RNase.
Incubate at 37 °C for00:30:00 .
Note
Mix on-bead reactions by gently flicking the tubes every 10 minutes.
On-Bead 5’ Decapping
On-Bead 5’ Decapping
1h 15m
1h 15m
Place the tubes on a magnet stand and remove supernatant.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
Always quickly spin samples down using a picofuge to remove liquid from tube caps.
Note
Do not allow streptavidin beads to dry completely, as this can lead to clumping and make full resuspension impossible. When processing multiple samples, remove liquid from the previous wash or enzymatic step from the first sample and immediately resuspend those beads in the next solution, then repeat this process for additional samples.
Resuspend the beads in 19 µL RppH mix (Vf = 20 µL ):
| Reagent | Volume | |
| DEPC-treated ddH2O | 15 µL | |
| 10X ThermoPol Buffer | 2 µL | |
| RppH | 1 µL | |
| SUPERase-In RNase Inhibitor | 1 µL |
Note
On-bead reaction volumes assume that 1 µL of liquid remains on the beads.
Note
We have also successfully used Cap-Clip™ Acid Pyrophosphatase (CELLTREAT) instead of RppH. Cap-Clip has lower buffer pH which may alleviate base hydrolysis of RNA that could occur in the pH 8.0 ThermoPol buffer. However, this is not a major concern except for in the most sensitive of applications.
Note
When preparing enzymatic reaction mixtures that contain SUPERase-In RNase Inhibitor, a fixed volume (1 µL) SUPERase-In can be added to the entire master mix regardless of number of reactions to decrease cost. Bring the remainder of the master mix up to the required volume with DEPC H2O. Murine RNase inhibitor can also be substituted to limit costs for all steps after the run-on. SUPERase-In is recommended prior to the run-on as it inhibits T1 RNase.
Incubate at 37 °C for01:00:00 .
Note
Mix on-bead reactions by gently flicking the tubes every 10 minutes.
On-Bead 5’ RNA Adaptor Ligation
On-Bead 5’ RNA Adaptor Ligation
1h 15m
1h 15m
Place the tubes on a magnet stand and remove supernatant.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
Always quickly spin samples down using a picofuge to remove liquid from tube caps.
Note
Do not allow streptavidin beads to dry completely, as this can lead to clumping and make full resuspension impossible. When processing multiple samples, remove liquid from the previous wash or enzymatic step from the first sample and immediately resuspend those beads in the next solution, then repeat this process for additional samples.
Resuspend the beads in 7 µL adapter mix (Vf = 8 µL ):
| Reagent | Volume | |
| DEPC-treated ddH2O | 6 µL | |
| REV5 (10 µM) | 1 µl |
Note
The concentration of RNA adapters in the ligation steps (1 µL 10 µM) is optimal for approximately 106 mammalian cells. For lower cell numbers, the adapter concentration must be diluted to limit dimer formation. We dilute linearly with cell concentration relative to this established concentration, i.e. 1 µL 5 µM for 5 x 105 cells, 1 µL 2.5 µM for 2.5 x 105 cells, etc.
Denature at 65 °C for 00:00:30 , then snap cool On ice .
Prepare ligation mix in the following order:
| Reagent | Volume | |
| 10X T4 RNA ligase buffer | 2 µL | |
| ATP (10 mM) | 2 µL | |
| SUPERase-In RNase Inhibitor | 1 µL | |
| 50% PEG8000 | 6 µL | |
| T4 RNA Ligase 1 (ssRNA ligase) | 1 µL |
Note
Pipette slowly because 50% PEG8000 is very viscous. Heating 50% PEG8000 makes it easier to pipette. Pipette the ligation mix until it is homogenous before use.
Note
Pipette slowly because 50% PEG8000 is very viscous. Heating 50% PEG8000 makes it easier to pipette. Pipette the ligation mix until it is homogenous before use.
Note
On-bead reaction volumes assume that 1 µL of liquid remains on the beads.
Add 12 µL to each tube (Vf = 20 µL ).
Incubate at 25 °C for 01:00:00 .
Note
Mix on-bead reactions by gently flicking the tubes every 10 minutes.
TRIzol Elution of RNA
TRIzol Elution of RNA
1h
1h
Wash once with 500 µL High Salt Wash buffer with tube swap.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
For each washing step gently invert tubes 10–15X, quickly spin down with a picofuge, open caps, and then place on the magnet stand. Wait 1-2 minutes and pipette the supernatant off without disturbing the beads. If there are bubbles in the tube carefully pipette them off first and then remove supernatant. Beware that bubbles may dislodge beads from the side of the tube. After removing the bulk of the liquid, collect remaining liquid with a quick spin in a picofuge, place the tube back on the magnet stand, and carefully remove remaining liquid by pipetting.
Note
Transferring beads to a new tube after the binding incubation—during the high salt wash step—helps limit adapter dimer formation. After resuspending the beads in High Salt buffer, quickly spin down with a picofuge, resuspend beads by gently pipetting, and carefully transfer to a new tube. Pipette slowly to avoid bead loss! Place this new tube on the magnet stand and proceed with the washing protocol.
Wash once with 500 µL Low Salt Wash buffer.
Note
Be careful not to disturb beads when removing buffers from tubes. Open tube caps prior to placing them on the magnet stand, as opening on the magnet stand can disturb the liquid. Check pipette tip against a white background before discarding liquid to ensure beads are not present.
Note
For each washing step gently invert tubes 10–15X, quickly spin down with a picofuge, open caps, and then place on the magnet stand. Wait 1-2 minutes and pipette the supernatant off without disturbing the beads. If there are bubbles in the tube carefully pipette them off first and then remove supernatant. Beware that bubbles may dislodge beads from the side of the tube. After removing the bulk of the liquid, collect remaining liquid with a quick spin in a picofuge, place the tube back on the magnet stand, and carefully remove remaining liquid by pipetting.
Note
Do not allow streptavidin beads to dry completely, as this can lead to clumping and make full resuspension impossible. When processing multiple samples, remove liquid from the previous wash or enzymatic step from the first sample and immediately resuspend those beads in the next solution, then repeat this process for additional samples.
Resuspend beads in 300 µL TRIzol.
Vortex at max speed for > 00:00:20 , then incubate On ice for 00:03:00 .
Add 60 µL chloroform.
Note
When pipetting chloroform, always pipette twice because the first draw always leaks.
Vortex at max speed for 00:00:15 , then incubate On ice for 00:03:00 .
Centrifuge at > 20,000 x g for 00:08:00 at 4 °C .
Transfer the aqueous phase (~180 µL ) to a new tube.
Note
When transferring the aqueous phase of TRIzol extractions to a new tube, tilt the tube to a 45° angle and carefully remove only the clear liquid. Avoid contamination by the pink organic phase or white interphase.
Add 1 µL GlycoBlue and mix.
Add 2.5X volumes (~450 µL ) 100 % (v/v) ethanol and vortex.
Centrifuge the samples at > 20,000 x g for 00:20:00 at 4 °C .
Note
A blue pellet should be visible at the bottom of tube. The pellet can be difficult to see but should be visible. It may appear spread out. If a pellet is not visible, vortex well and repeat spin.
Carefully pipette supernatant off and discard.
Note
When removing the supernatant before the 70% ethanol wash be careful not to disturb the pellet. Approximately 30–50μL of ethanol can be left in the tube to avoid disturbing the pellet prior to adding the 70% ethanol wash. This procedure can also be used after the 70% ethanol wash (step 63), but then remove the final 30-50 µL using a P200 tip after a quick spin in a picofuge.
Add 750 µL 70 % (v/v) ethanol.
Mix by gentle inversion and quickly spin down.
Carefully pipette supernatant off and discard.
Airdry the RNA pellet.
Note
Air dry the RNA pellet by leaving tubes open in fume hood to prevent contamination. This will take ~3-10 min depending on how much ethanol is left in the tube. Do not to let the RNA pellet dry completely as this will greatly decrease its solubility.
Off-Bead Reverse Transcription
Off-Bead Reverse Transcription
1h 15m
1h 15m
Resuspend RNA pellet in 13.5 µL RT resuspension mix:
| Reagent | Volume | |
| DEPC-treated ddH2O | 8.7 µL | |
| Primer RP1 (10 µM) | 4 µL | |
| dNTP mix (12.5 mM each) | 0.8 µL |
Note
Reverse transcription can also be performed on-bead, but we find that this significantly reduces library yield while increasing adapter dimer. For this reason, it is not recommended except in cases where material is abundant (107 cells) and speed is paramount. To do this, follow steps 49 and 50, then skip to step 65, but resuspend the beads instead of the RNA pellet in RT resuspension mix. After RT, elute cDNA by heating the bead mixture to 95°C, quickly place tubes on a magnet stand, and remove and save supernatant. Resuspend beads in 20 µL ddH2O and repeat the process for a final volume of 40 µL. Proceed with PreCR but use 20 µL less ddH2O (13.5 µL) in the PreCR mix and use the entire 40 µL eluate instead of the 20 µL RT mix.
1.Denature at 65 °C for 00:05:00 and snap cool On ice .
1.Prepare RT master mix:
| Reagent | Volume | |
| 5X RT Buffer | 4 µL | |
| 100 mM DTT | 1 µL | |
| SUPERase-In RNase Inhibitor | 0.5 µL | |
| Maxima H Minus RT enzyme | 1 µL |
Add 6.5 µL to each sample (Vf = 20 µL ).
Cycle as follows:
a. 50 °C for 00:30:00
b. 65 °C for 00:15:00
c. 85 °C for 00:05:00
d. hold at 4 °C .
Immediately proceed to PreCR, test amplification, or full-scale amplification. Samples can be stored overnight at -20 °C (see Notes 38–39).
Note
PreCR is optional if full scale amplification will be performed within 2 days. Longer storage of single-stranded cDNA libraries can lead to loss of library material. If you are skipping PreCR, simply store the 20 µL RT reaction at -20°C overnight and perform test amplification the next day.
Note
Because this protocol uses molecular barcodes (UMIs) which facilitate robust computational PCR deduplication, it is less important to precisely determine the optimal cycle number. We recommend performing test amplification the first time you perform this protocol with a given amount of material from a given cell line to determine the optimal cycle number. For future experiments where the material and cell number are constant, test amplification can be skipped. Adjust the volume of the full-scale PCR to 100 µL total volume (accounting for the fact that the written protocol assumes loss due to test amplification). Test amplification can be performed either by PCR of a dilution curve and PAGE analysis or qPCR.
PreCR
PreCR
1h 30m
1h 30m
Note
Because this protocol uses molecular barcodes (UMIs) which facilitate robust computational PCR deduplication, it is less important to precisely determine the optimal cycle number. We recommend performing test amplification the first time you perform this protocol with a given amount of material from a given cell line to determine the optimal cycle number. For future experiments where the material and cell number are constant, test amplification can be skipped. Adjust the volume of the full-scale PCR to 100 µL total volume (accounting for the fact that the written protocol assumes loss due to test amplification). Test amplification can be performed either by PCR of a dilution curve and PAGE analysis or qPCR.
Add 2.5 µL RPI-n indexed primer (10 micromolar (µM) ) to each sample. Use different barcodes for samples that will be pooled and sequenced together.
Prepare the PreCR master mix:
| Reagent | Volume | |
| ddH2O | 33.5 µL | |
| 5X Q5 Buffer | 20 µL | |
| 5X Q5 Enhancer | 20 µL | |
| Primer RP1 (10 µM) | 1 µL | |
| dNTP mix (12.5 mM each) | 2 µL | |
| Q5 Polymerase | 1 µL |
Add 77.5 µL of the PreCR mix to each sample for final volume 100 µL .
Note
Do not attempt to scale down the PreCR or full-scale amplification steps to save PCR reagents. If RT reaction mixture exceeds 20% of the PCR reaction volume, significant inhibition of PCR will occur and lead to dramatically lower final library yield.
Amplify libraries for 5 cycles on thermal cycler using the following settings:
a. 95 °C for 00:02:00
b. 95 °C for 00:00:30
c. 56 °C for 00:00:30
d. 72 °C for 00:00:30
e. Go to b. 4 more times
f. 72 °C for 00:05:00
g. Hold at 4 °C
Store samples at -20 °C or proceed to test amplification.
Test Amplification (Gel)
Test Amplification (Gel)
4h
4h
Note
Because this protocol uses molecular barcodes (UMIs) which facilitate robust computational PCR deduplication, it is less important to precisely determine the optimal cycle number. We recommend performing test amplification the first time you perform this protocol with a given amount of material from a given cell line to determine the optimal cycle number. For future experiments where the material and cell number are constant, test amplification can be skipped. Adjust the volume of the full-scale PCR to 100 µL total volume (accounting for the fact that the written protocol assumes loss due to test amplification). Test amplification can be performed either by PCR of a dilution curve and PAGE analysis or qPCR
Note
Taking 7.7 µL of the 100 µL PreCR reaction leaves 92.3 µL for full-scale amplification. 25% of material in the first dilution is lost to make the next serial 4-fold dilution (2 of 8 µL). Because (7.7 * 0.75) / 92.3 ≈ 1/16, this first dilution is equivalent to the number of test amplification cycles less 4. If starting from the RT reaction, the volume has been adjusted for 5-fold lower starting volume.
Make the first dilution using one of the following options:
If PreCR was performed, add 7.7 µL of the 100 µL PreCR reaction to 0.3 µL ddH2O for a final volume of 8 µL .
If PreCR was skipped, add 1.54 µL of the 20 µL RT reaction to 6.46 µL ddH2O for a final volume of 8 µL .
Make 4-fold serial dilutions by adding 2 µL of each dilution to 6 µL ddH2O for the next dilution.
Remove and discard 2 µL from the final dilution (all dilutions should now be 6 µL ).
Choose a target number of total cycles for test amplification using the table below (see Note 42). The first dilution simulates full-scale amplification at the total number of cycles (PreCR cycles + Test Amp cycles) minus 4. Subtract 2 cycles sequentially for the following dilutions.
| Dilution | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | |
| 19 Total Cycles | 15 | 13 | 11 | 9 | 7 | 5 | 3 | 1 | |
| 21 Total Cycles | 17 | 15 | 13 | 11 | 9 | 7 | 5 | 3 | |
| 23 Total Cycles | 19 | 17 | 15 | 13 | 11 | 9 | 7 | 5 |
Note
Additional cycles can vary by cell type. For HeLa, we typically perform 14 additional cycles (19 total cycles), which simulates 15 full-scale amplification cycles. For low input libraries (50k-250k mammalian cells), we typically perform 20 additional cycles (23 cycles total), which simulates 21 full-scale amplification cycles.
Make test PCR mix:
| Reagent | Volume | |
| ddH2O | 4.4 µL | |
| 5X Q5 Buffer | 4 µL | |
| 5X Q5 Enhancer | 4 µL | |
| Primer RP1 (10 µM) | 0.5 µL | |
| Primer RPI-n (10 µM) | 0.5 µL | |
| dNTP mix (12.5 mM each) | 0.4 µL | |
| Q5 Polymerase | 0.2 µL |
Add 14 µL PCR mix to the 6 µL diluted test samples (Vf = 20 µL ).
Amplify reactions for the desired amount of cycles using following settings:
Safety information
CRITICAL Remember to account for PreCR. Subtract 5 cycles from your total target test amplification cycles.
a. 95 °C for 00:02:00
b. 95 °C for 00:00:30
c. 65 °C for 00:00:30
d. 72 °C for 00:00:30
e. Go to step 2 for the desired number of cycles
f. 72 °C for 00:05:00
g. Hold at 4 °C
Note
If PreCR was skipped, use an annealing temperature of 56°C for the first 5 cycles of test amplification and the full-scale amplification.
Mix with gel loading dye to 1X and run 10 µL on a 2.2 Mass Percent Agarose gel or run 2 µL on a native 8 % (v/v) polyacrylamide gel and stain with SYBR Gold.
Use the test amplification gel to determine the appropriate number of cycles for full-scale amplification.
Note
Desired amplification characteristics include a sufficient amount of product (smear starting ~150 bp), no evidence of overamplification, and ~50% primer exhaustion. The adaptor dimer product is 132 bp, and the smear will start 15–20 bp above this band. RNA degradation will lead to shorter library products. See:
CITATION
3.14 Test Amplification (qPCR)
3.14 Test Amplification (qPCR)
4h
4h
Note
Because this protocol uses molecular barcodes (UMIs) which facilitate robust computational PCR deduplication, it is less important to precisely determine the optimal cycle number. We recommend performing test amplification the first time you perform this protocol with a given amount of material from a given cell line to determine the optimal cycle number. For future experiments where the material and cell number are constant, test amplification can be skipped. Adjust the volume of the full-scale PCR to 100 µL total volume (accounting for the fact that the written protocol assumes loss due to test amplification). Test amplification can be performed either by PCR of a dilution curve and PAGE analysis or qPCR
Add 1.54 µL of the 20 µL RT reaction to 0.46 µL ddH2O (Vf = 2 µL ).
Make the qPCR master mix:
| Reagent | Volume | |
| Primer RP1 (10 µM) | 0.25 µL | |
| Primer RPI-n (10 µM) | 0.25 µL | |
| 2X SsoAdvanced Universal SYBR Green Supermix | 5 µL | |
| ddH2O | 2.5 µL |
Add 8 µL of the qPCR master mix to 2 µL diluted RT reaction (Vf = 10 µL ).
Quickly spin plate to collect liquid.
Amplify in a real-time PCR system using the following conditions:
Amplification
a. 98 °C for 00:02:00
b. 98 °C for 00:00:15
c. 60 °C for 00:01:00
d. Go to step 2 for 39 additional cycles
Melt Curve
a.95 °C for 00:00:15
b. 60 °C for 00:01:00
c. 96 °C for 00:00:15
d. 60 °C for 00:00:16
Calculate the number of full-scale amplification cycles as the cycle number where Rn reaches 0.25 × Rnmax.
Full-Scale Amplification
Full-Scale Amplification
1h 30m
1h 30m
If PreCR and Test Amplification were skipped:
Add 2.5 µL of an RPI-n indexed primer (10 micromolar (µM) ) to each 20 µL RT reaction. Use different barcodes for samples that will be pooled and sequenced on a single lane.
Prepare the PCR master mix:
| Reagent | Volume | |
| ddH2O | 33.5 µL | |
| 5X Q5 Buffer | 20 µL | |
| 5X Q5 Enhancer | 20 µL | |
| Primer RP1 (10 µM) | 1 µL | |
| dNTP mix (12.5 mM each) | 2 µL | |
| Q5 Polymerase | 1 µL |
Note
Do not attempt to scale down the PreCR or full-scale amplification steps to save PCR reagents. If RT reaction mixture exceeds 20% of the PCR reaction volume, significant inhibition of PCR will occur and lead to dramatically lower final library yield.
Add 77.5 µL PCR master mix to each sample for final volume 100 µL .
Run the desired number of cycles:
a. 95 °C for 00:02:00
b. 95 °C for 00:00:30
c. 56 °C for 00:00:30
d. 72 °C for 00:00:30
e. Go to step (b) for 4 more cycles.
f. 95 °C for 00:00:30
g. 65 °C for 00:00:30
h. 72 °C for 00:00:30
i. Go to step (f) for the desired number of cycles
j. Hold at 4 °C
If PreCR was skipped but Test Amplification was performed:
Add 2.5 µL of an RPI-n indexed primer (10 micromolar (µM) ) to the remaining 18.5 µL RT reaction. Use different barcodes for samples that will be pooled and sequenced on a single lane.
Prepare the PCR master mix:
| Reagent | Volume | |
| ddH2O | 35 µL | |
| 5X Q5 Buffer | 20 µL | |
| 5X Q5 Enhancer | 20 µL | |
| Primer RP1 (10 µM) | 1 µL | |
| dNTP mix (12.5 mM each) | 2 µL | |
| Q5 Polymerase | 1 µL |
Note
Do not attempt to scale down the PreCR or full-scale amplification steps to save PCR reagents. If RT reaction mixture exceeds 20% of the PCR reaction volume, significant inhibition of PCR will occur and lead to dramatically lower final library yield.
Add 79 µL PCR master mix to each sample for final volume 100 µL .
Run the desired number of cycles:
a. 95 °C for 00:02:00
b. 95 °C for 00:00:30
c. 56 °C for 00:00:30
d. 72 °C for 00:00:30
e. Go to step (b) for 4 more cycles.
f. 95 °C for 00:00:30
g. 65 °C for 00:00:30
h. 72 °C for 00:00:30
i. Go to step (f) for the desired number of cycles
j. Hold at 4 °C
If PreCR and Test Amplification were performed:
Prepare the following spike-in PCR mix:
| Reagent | Volume | |
| ddH2O | 3.7 µL | |
| 5X Q5 Buffer | 1.5 µL | |
| 5X Q5 Enhancer | 1.5 µL | |
| dNTP mix (12.5 mM) | 0.5 µL | |
| Q5 Polymerase | 0.5 µL |
Add 7.7 µL PCR spike-in mix to each sample for final volume 100 µL .
Run the desired number of cycles.
a. 95 °C for 00:02:00
b. 95 °C for 00:00:30
c. 65 °C for 00:00:30
d. 72 °C for 00:00:30
e. Go to step (b) for the desired number of cycles
f. Hold at 4 °C
Safety information
Remember to account for PreCR. Subtract 5 cycles from your total target full-scale amplification cycles.
Allow PCR reactions to reach room temperature.
Add 180 µL SPRI beads (see Note 45) at room temperature and immediately mix by pipetting > 15X.
Incubate at Room temperature for 00:05:00 .
Place on a magnet stand and remove the supernatant.
Wash the beads twice with 70 % (v/v) ethanol without resuspending.
Safety information
Do not disturb the beads or library recovery will be greatly reduced.
Airdry the beads for 00:05:00 . Do not over dry the beads.
Resuspend beads in 22 µL 10 millimolar (mM) Tris-Cl, 8.0 (no EDTA).
Incubate at room temperature for 00:05:00 .
Place the beads on a magnet stand and transfer 20 µL to a new tube.
Quantify the library using the Qubit dsDNA-HS assay and run on a Bioanalyzer.
PAGE purification
PAGE purification
1d
1d
Note
Due to advances in streptavidin bead technology and titration of adapters presented in this protocol, PAGE purification is rarely necessary. We prefer to sequence libraries that are 0%–25% adapter dimer rather than risk size bias associated with gel purification. Only perform PAGE purification if absolutely necessary. If needed, multiple libraries can be pooled by molarity as determined by bioanalyzer and extracted from the same gel lane to minimize size bias.
Add Orange G loading dye to 1X to the entire library volume.
Run the samples on a native 8 % (v/v) polyacrylamide gel.
Stain with SYBR Gold.
Cut a gel slice from immediately above the adapter dimer to ~650 bp.
Note
Desired amplification characteristics include a sufficient amount of product (smear starting ~150 bp), no evidence of overamplification, and ~50% primer exhaustion. The adaptor dimer product is 132 bp, and the smear will start 15–20 bp above this band. RNA degradation will lead to shorter library products. See:
CITATION
Place the gel slice in a 0.5 mL microfuge tube.
Make a hole in the bottom of the tube with an 18G needle.
Nest the 0.5 mL tube in a 1.5 mL tube and spin at 5000 x g for 00:01:00 .
If gel remains in the 0.5 mL tube, repeat step 7 and pool shredded gel fractions by suspending each in 250 µL soaking buffer using a wide-bore P1000 tip.
Soak the gel pieces in 0.5 mL soaking buffer (TE + 150 millimolar (mM) NaCl + 0.1 % (v/v) Tween-20) overnight with agitation at 37 °C .
Spin the tube at 5000 x g for 1 min.
Pipette as much of the soaking buffer as possible without transferring gel pieces into a new tube.
Add an additional 0.5 mL soaking buffer and incubate 04:00:00 at 37 °C with agitation.
Spin the tube at 5000 x g for 00:01:00 .
Pipette as much of the soaking buffer as possible without transferring gel pieces into the tube with the previous eluate.
Pass the remaining gel solution through a Costar Spin-X column using a cut P1000 tip and pool with the previous eluate (Vf = 1 mL )
Reduce the volume by half (Vf = 0.5 mL ) using vacuum dryer at 37 °C .
Add 1 µL GlycoBlue.
Add 2.5X volume (1.25 mL ) 100 % (v/v) ethanol and vortex.
Centrifuge at >20,000 x g for 00:20:00 at 4 °C .
Note
A blue pellet should be visible at the bottom of tube. The pellet can be difficult to see but should be visible. It may appear spread out. If a pellet is not visible, vortex well and repeat spin.
Carefully pipette off the supernatant and discard.
Note
When removing the supernatant before the 70% ethanol wash be careful not to disturb the pellet. Approximately 30–50μL of ethanol can be left in the tube to avoid disturbing the pellet prior to adding the 70% ethanol wash. This procedure can also be used after the 70% ethanol wash, but then remove the final 30-50 µL using a P200 tip after a quick spin in a picofuge.
Add 750 µL of 75 % (v/v) ethanol.
Mix by gentle inversion and quickly spin down.
Carefully pipette off the supernatant and discard.
Air-dry the RNA pellet.
Note
Air dry the RNA pellet by leaving tubes open in fume hood to prevent contamination. This will take ~3-10 min depending on how much ethanol is left in the tube. Do not to let the RNA pellet dry completely as this will greatly decrease its solubility.
Resuspend the pellet in the desired volume of 10 millimolar (mM) Tris-Cl, 8.0 , no EDTA
Computational Analysis
Computational Analysis
A pipeline for alignment of PRO-seq data can be found here: https://github.com/JAJ256/PROseq_alignment.sh