A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR
Mar 17, 2020

A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR V.1

  • Mammoth Biosciences1,
  • James P. Broughton2,
  • Wayne Deng3,4,
  • Clare L. Fasching2,
  • Jasmeet Singh2,
  • Charles Y. Chiu3,4,5,
  • Janice S. Chen2
  • 1[Mammoth Biosciences, Inc., South San Francisco, California, USA];
  • 2Mammoth Biosciences, Inc., South San Francisco, California, USA;
  • 3Department of Laboratory Medicine, University of California, San Francisco, California, USA;
  • 4UCSF-Abbott Viral Diagnostics and Discovery Center, San Francisco, California, USA;
  • 5Department of Medicine, Division of Infectious Diseases, University of California, San Francisco, California, USA
Abstract
***DISCLAIMER: This protocol has not been approved by the FDA and should not be used as a clinical diagnostic***


Introduction

Given the global health emergency, rapid transmission, and severe respiratory disease associated with the outbreak of the 2019 novel coronavirus (SARS-CoV-2), Mammoth Biosciences has reconfigured our DETECTR platform to rapidly and accurately detect SARS-CoV-2 using a visual lateral flow strip format within 30 minutes from sample to result. To ensure specificity of detection, we selected a high-fidelity CRISPR detection enzyme and designed sets of gRNAs that can either 1) differentiate SARS-CoV-2 or 2) provide multi-coronavirus strain detection. SARS-CoV-2 DETECTR couples CRISPR detection with isothermal pre-amplification using primers based on protocols validated by the US Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO). Currently in the United States, the CDC SARS-CoV-2 real-time RT-PCR diagnostic panel has a laboratory turnaround time of approximately 4-6 hours, with results that can be delayed for >24 hours after sample collection due to shipping requirements. In addition, these tests are only available in CDC-designated public health laboratories certified to perform high-complexity testing.

Mammoth is working to enable point of care testing (POCT) solutions that can be deployed in areas at greatest risk of transmitting SARS-CoV-2 infection, including airports, emergency departments, and local community hospitals, particularly in low-resource countries. Leveraging an “off-the-shelf” strategy to enable practical solutions within a short time frame, we describe here a protocol that is fast (<30 min), practical (available immediately from international suppliers), and validated using contrived samples.


Steps.JPG
Specifications
Targets● N-gene (SARS-CoV-2 specific) ● E-gene (SARS-CoV, bat-SARS-like-CoV, and SARS-CoV-2 coronaviruses) ● RNase P (human sample control)
Limit of detection70-300 copies/μl input
Table 1: SARS-CoV-2 DETECTR assay workflow and specifications.

Figure 1.JPG
Figure 1: SARS-CoV-2 DETECTR has a limit of detection (n=7) of 156-625 copies per 20 μl reaction (or 70-300 copies per μl input) and generates a clear visible signal on lateral flow strips within 30 minutes sample to result.


Acknowledgements: We thank Vikram Joshi, Nefeli Tsaloglou and Xin Miao for advice and helpful discussions in the preparation of this whitepaper.

Conflicts of Interest: JPB, CLF, JS and JSC are employees of Mammoth Biosciences, CYC is on the Scientific Advisory Board of Mammoth Biosciences, and JSC is a co-founder of Mammoth Biosciences. JPB, CLF, JS, CYC and JSC are co-inventors on CRISPR-related technologies.
Attachments
PROTOCOL citation
Mammoth Biosciences, James P. Broughton, Wayne Deng, Clare L. Fasching, Jasmeet Singh, Charles Y. Chiu, Janice S. Chen 2020. A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR. protocols.iohttps://dx.doi.org/10.17504/protocols.io.bcmtiu6n
Keywords
coronavirus, SARS, SARS-CoC-2, CRISPR, SARS-CoV-2 DETECTR
License
This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created
Feb 17, 2020
Last Modified
Mar 17, 2020
Ownership history
  • Feb 17, 2020
    Julia Rossmanith
    protocols.io
  • Mar 10, 2020
    Mammoth Biosciences
PROTOCOL integer ID
33171
Guidelines
Appendix

While we were preparing this whitepaper, another protocol for SARS-CoV-2 detection using CRISPR diagnostics (SHERLOCK, v.20200214) was published. We compare the assay workflows and specifications between CRISPR diagnostics and established CDC/WHO protocols below. (Note: as of this publication, CRISPR diagnostics workflows have not yet been approved by the FDA)

Appendix Figure 1.JPG
Appendix Figure 1: Comparison of SARS-CoV-2 assay workflows for DETECTR,
SHERLOCK, and CDC/WHO

SARS-CoV-2 DETECTRSARS-CoV-2 SHERLOCKCDC SARS-CoV2 qRT-PCR
TargetN gene & E gene (N gene gRNA compatible with CDC N2 amplicon, E gene compatible with WHO protocol)S gene & Orf1ab geneN-gene (3 amplicons)
Sample controlRNase PNoneRNase P
Limit of Detection70-300 copies/μl input10-100 copies/μl input1 copy/μL input
Assay reaction time~30 min~60 min~45-60 minutes
Assay componentsRT-LAMP (62 °C, 290 min), Cas12 (37 °C, 10 min), Lateral flow (RT, 2 min)RT-RPA (42 °C, 25 min), IVT + Cas13 (37 °C, 30 min), Lateral flow (RT, 2 min)UDG digestion (25 °C, 2 min), reverse transcription (50 °C, 15 min), denature (95 °C, 2 min), amplification (95 °C, 3 min; 55 °C 30 sec; 45 cycles)
Heavy instrumentation requiredNoNoYes
FDA EUA approvalNoNoYes
Appendix Tavle 1: Comparison of SARS-CoV-2 specifications for CRISPR diagnostic
protocols to the current CDC assay.

MATERIALS TEXT
STEP MATERIALS
WarmStart LAMP Kit (DNA and RNA) - 100 rxnsNew England BiolabsCatalog #E1700S
SARS-CoV-2 DETECTR Reagents

Step 1: Isothermal amplification (62°C, 20 min)

  • RT-LAMP Master Mix (Supplier: NEB)
WarmStart LAMP Kit (DNA and RNA) - 100 rxnsNew England BiolabsCatalog #E1700S


  • Primer sequences:
NameSequence (5’ → 3’)
N-gene F3AACACAAGCTTTCGGCAG
N-gene B3GAAATTTGGATCTTTGTCATCC
N-gene FIPTGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC
N-gene BIPCGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG
N-gene LFTTCCTTGTCTGATTAGTTC
N-gene LBACCTTCGGGAACGTGGTT
E-gene F3CCGACGACGACTACTAGC
E-gene B3AGAGTAAACGTAAAAAGAAGGTT
E-gene FIPACCTGTCTCTTCCGAAACGAATTTGTAAGCACAAGCTGATG
E-gene BIPCTAGCCATCCTTACTGCGCTACTCACGTTAACAATATTGCA
E-gene LFTCGATTGTGTGCGTACTGC
E-gene LBTGAGTACATAAGTTCGTAC
RNaseP POP7 F3*TTGATGAGCTGGAGCCA
RNaseP POP7 B3*CACCCTCAATGCAGAGTC
RNaseP POP7 FIP*GTGTGACCCTGAAGACTCGGTTTTAGCCACTGACTCGGATC
RNaseP POP7 BIP*CCTCCGTGATATGGCTCTTCGTTTTTTTCTTACATGGCTCTGGTC
RNaseP POP7 LF*ATGTGGATGGCTGAGTTGTT
RNaseP POP7 LB*CATGCTGAGTACTGGACCTC
* RNaseP POP7 primers published in Curtis et al. , (2018) .

Curtis KA, Morrison D, Rudolph DL, Shankar A, Bloomfield LSP, Switzer WM, Owen SM (2018). A multiplexed RT-LAMP assay for detection of group M HIV-1 in plasma or whole blood.. Journal of virological methods.


Step 2: Cas12 detection (37°C, 10 min)

  • LbCas12a (Supplier: NEB)
EnGen Lba Cas12a (Cpf1) - 70 pmolNew England BiolabsCatalog #M0653S

NameSequence (5’ → 3’)
N gene gRNA (SARS-CoV-2 specific)UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC
E gene gRNA (pan-coronavirus)UAAUUUCUACUAAGUGUAGAUGUGGUAUUCUUGCUAGUUAC
RNase P gRNA (Sample control)UAAUUUCUACUAAGUGUAGAUGACCUGCGAGCGGGUUCUGA
Reporter/56-FAM/TTATTATT/3Bio/

Step 3: Lateral flow (RT, 2 min)




Sample Equipment

  • Pipette tips
  • 37 °C heat block
  • 62°C heat block
  • Microcentrifuge
  • Eppendorf tubes
  • Pipettes
  • Lateral flow strips
  • Sample collection device (nasopharyngeal swab)
  • Timer
Safety warnings
Please see SDS (Safety Data Sheet) for hazards and safety warnings.

Prepare nucleic acid sample and CRISPR reagents

1
Extract patient RNA following CDC recommendations.
2
Prepare LbCas12a RNP complexes for the samples to be tested. One complex for N-gene, E-gene, and RNase P gRNAs is needed for each sample.
ReagentVolumeFinal Concentration
Nuclease-free water15.75 μl 
10X NEBuffer 2.12 μl1X
1 μM LbCas12a1 μl50 nM
1 μM gRNA1.25 μl62.5 nM
TOTAL VOLUME20 μl 

3
Incubate LbCas12a with gRNA to generate RNP complexes for 00:30:00 at 37 °C .
4
Add reporter substrate to final concentration of 500 Nanomolar (nM) .
5
Place reactions On ice until ready to proceed.
Complexes are stable at 4°C for at least 24 hours.


Run DETECTR reaction

6
On ice , prepare three RT-LAMP reactions, one each for N-gene, E-gene, and
RNase P primer sets:
ReagentVolumeFinal Concentration
10X Isothermal Amplification Buffer (NEB)2.5 μl 
100 mM MgSO 4 (NEB)1.13 μl6.5 mM (4.5 mM added, 2 mM in 1X IsoAmp Buffer)
10 mM dNTPs (NEB)3.5 μl1.4 mM
10X Primer Mix2.5 μl0.2 μM F3 / 0.2 μM B3 / 1.6 μM FIP / 1.6 μM BIP / 0.8 μM LF / 0.8 μM LB
Bst 2.0 polymerase (NEB)1 μl8 units / rxn
Warmstart RTx (NEB)0.5 μl7.5 units / rxn
Nuclease-free water3.87 μl 
Nucleic acid sample5 μl 
TOTAL VOLUME25 μl 

7
Incubate at 62 °C for 00:20:00 .
Note: Use precaution when opening amplification tubes to prevent
amplicon contamination.

8
Combine 2 µl of the RT-LAMP reaction with 20 µl of the LbCas12a RNP
complex with the appropriate gRNA.
9
Add 80 µl 1X NEBuffer 2.1 .
10
Incubate at 37 °C for 00:10:00 .
11
Insert Milenia HybriDetect 1 (TwistDx) lateral flow strip directly into reaction.
12
Allow the lateral flow strip to run for 00:02:00 at Room temperature and observe
the result.

Test interpretation

13
Note: The line closest to the sample pad is the control line and the line that appears
farthest from the sample pad is the test line (see Figure 1). A sample with complete
cleavage of the reporter molecule may appear to have no signal at the control line.


Screenshot 2020-03-03 at 10.51.51.png
Figure 1 | SARS-CoV-2 DETECTR has a limit of detection (n=7) of 156-625 copies per 20 µl reaction (or 70-300 copies per µl input) and generates a clear visible signal on lateral flow strips within 30 minutes sample to result.

N-geneE-geneRNase PInterpretation
+++/-SARS-CoV-2 positive
+-+/-Indeterminate
-++/-Indeterminate
--+SARS-CoV-2 negative
---QC failure