Jul 11, 2023
A new metabarcoding approach to survey diversity at the species level of Arcellinida (Amoebozoa: Tubulinea)
- 1Real_Jardín_Botánico_CSIC
External link: https://doi.org/10.1111/1755-0998.13771
Protocol Citation: R. González-Miguéns 2023. A new metabarcoding approach to survey diversity at the species level of Arcellinida (Amoebozoa: Tubulinea). protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvm2389g3p/v1
Manuscript citation:
González-Miguéns, R., Cano, E., Guillén-Oterino, A., Quesada, A., Lahr, D. J. G., Tenorio-Rodríguez, D., de Salvador-Velasco, D., Velázquez, D., Carrasco-Braganza, M. I., Patterson, R. T., Lara, E., & Singer, D. (2023). A needle in a haystack: A new metabarcoding approach to survey diversity at the species level of Arcellinida (Amoebozoa: Tubulinea). Molecular Ecology Resources, 23, 1034–1049. https://doi.org/10.1111/1755-0998.13771
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 22, 2022
Last Modified: July 11, 2023
Protocol Integer ID: 73112
Keywords: diversity at the species level, species level, new metabarcoding approach, arcellinida, amoebozoa, pcr protocol, diversity, pcr protocol for the paper
Abstract
PCR protocol for the paper:" A needle in a haystack: a new metabarcoding approach to survey diversity at the species level of Arcellinida (Amoebozoa: Tubulinea)"
Polymerase Chain Reaction protocol
First PCR
Primers:
Primer forward: LCO 1490 (5´ GGTCAACAAATCATAAAGATATTGG 3´)
Primer reverse: HCO 2198 (5´ TAAACTTCAGGGTGACCAAAAAATCA 3´)
Reagents for the PCR:
| A | B | |
| Polymerase | 6 μL | |
| BSA | 1 μL | |
| Primer forward | 1 μL (10 μmol) | |
| Primer reverse | 1 μL (10 μmol) | |
| Destilated water | 1 μL | |
| Sample (eDNA) | 1 μL |
Total reaction mix per sample= 10 μL
Thermocycler program:
| A | B | C | D | |
| Temperature | Time | cycles | ||
| Initial denaturation | 96 °C | 5 min | 1 | |
| Denaturation | 94 °C | 15 s | 40 | |
| Annealing | 40 °C | 15 s | ||
| Extension | 72 °C | 90 s | ||
| Final extension | 72 °C | 10 min | 1 |
Denaturation temperatures and times may vary depending on the polymerase used. This protocol was tested with the MyTaq™ Red Mix™ polymerase.
Gel electrophoresis:
Analyze the results of your PCR reaction via gel electrophoresis. The resultant fragment was 692 bp long:
example of four PCR products with one negative control on the right. HyperLadder™ 1kb as the molecular weight marker.
Second PCR
Primers:
Primer forward: LCO 1490 (5´ GGTCAACAAATCATAAAGATATTGG 3´)
Primer reverse: ArCOIR (5´ CCACYNGAATGWGCTARAATACC 3´)
Reagents for the PCR:
| A | B | |
| Polymerase | 12 μL | |
| Primer forward | 1 μL (10 μmol) | |
| Primer reverse | 1 μL (10 μmol) | |
| Destilated water | 6 μL | |
| Sample (first PCR product) | 1 μL |
Total reaction mix per sample= 20 μL
Thermocycler program:
| A | B | C | D | |
| Temperature | Time | cycles | ||
| Initial denaturation | 96 °C | 5 min | 1 | |
| Denaturation | 94 °C | 15 s | 40 | |
| Annealing | 55 °C | 15 s | ||
| Extension | 72 °C | 90 s | ||
| Final extension | 72 °C | 10 min | 1 |
Denaturation temperatures and times may vary depending on the polymerase used. This protocol was tested with the MyTaq™ Red Mix™ polymerase.
Gel electrophoresis:
Analyze the results of your PCR reaction via gel electrophoresis. The resultant fragment was 407 bp long