Feb 16, 2024

A FAIR protocol of the Best-RAD sequencing approach

A FAIR protocol of the Best-RAD sequencing approach
  • 1Centre de coopération Internationale en Recherche Agronomique pour le Développement;
  • 2Institut National de la Recherche pour l'Agriculture, l'alimentation et l'Environnement
Icon indicating open access to content
QR code linking to this content
Protocol CitationLaure Benoit, Sabine Nidelet, Emeline Charbonnel, Marie-Pierre Chapuis 2024. A FAIR protocol of the Best-RAD sequencing approach. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vz3ok4gx1/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 27, 2021
Last Modified: March 21, 2024
Protocol Integer ID: 48598
Keywords: RAD sequencing, BestRAD, Sequence-Based Genotyping, PCR duplicate, multiplexing, adapters, biotinylated tag, SNP, high amount of target dna fragment, lower rate of pcr duplicate, low amounts of pcr duplicate, target dna fragment, dna concentration, pcr duplicate, sequencing, protocol on individual wild sample, sequencing approach, quantity of the dna input, oriental fruit fly, dna input, individual wild sample, dna, number of pcr cycle, pcr cycle, pcr, chimeric fragment, main improvements of the rad
Funders Acknowledgements:
Labex CEMEB
Grant ID: PROLAG project
ANR
Grant ID: DISLAND project
Abstract
The protocol is based on the Best-RAD sequencing approach developed in Ali et al. (2016) that allows two main improvements of the RAD-sequencing approach developed by Baird et al. (2008) : (1) a lower rate of PCR duplicates generated during the final enrichment and (2) an increase of the multiplexing capacity by a factor equal to the number of well barcode available (for a brief description, see Figure 1). We developed this protocol on individual wild samples of the Oriental fruit fly, Bactrocera dorsalis. We evaluated the library quality not only on a high amount of target DNA fragments but also on low amounts of PCR duplicates, chimeric fragments, and adaptor residues. To this aim, we tested and validated the following critical parameters : the quality and quantity of the DNA input, the ratio of the AMpure purifications and the number of PCR cycles of the final amplification. Consecutive recommendations and expectations (e.g., DNA concentration or fragment size) are indicated in notes throughout the protocol. Furthermore, special care has been taken to ensure the precision of each step (i.e. volumes, quantities, duration, materials with supplier references). Consequently, this protocol follows the FAIR principle and could be useful for an easy implementation of the Best-RAD sequencing approach in other laboratories and biological models.

Figure 1. Schematic overview of the BestRAD method (slightly modified from Ali et al. 2016). Part I: Two wells are depicted in each of two different plates. Genomic DNA is digested with a restriction enzyme and ligated to biotinylated well barcode adapters (yellow and blue bars). DNA from each well is pooled platewise, mechanically sheared. Part II: Pools are incubated with streptavidin beads. Following washing, DNA is cleaved from the beads leaving the well barcodes. Part III: Library preparation is performed where a unique combination of plate barcode is added (red and purple bars). Multiple plate libraries can be pooled.

Guidelines
Enzymes
Both PstI and SbfI enzymes are compatible with this protocol.

DNA quality
Wherever possible, select input DNA samples of a molecular weight of at least 5kb. A more degraded DNA sample could be lost and should be avoided. Note that we worked on DNA extracted using a 96-Well Plate Animal Genomic DNA Miniprep Kit (Biobasic, Toronto, Canada, Cat.#: BS437) according to the manufacturer’s protocol, except that lysis was made over-night and followed by an RNA degradation step using 4µL of RNase A (Qiagen, 100 mg/ml, Cat.#: 19101) during 2 min at room temperature.

Sample multiplexing
The protocol is designed to process samples in batches of 96 (i.e. to work in a 96-well plate format), but it is possible to work with fewer samples (e.g. batches of 24 samples).
Each sample must be associated to a unique ID and three multiplexing barcodes. These barcodes are :
(1) a well biotinylated barcode as defined by Ali et al. (2016) that is unique to a sample within a batch (the list of barcode sequences is available in the Supplementary data FileS1; "New RAD" table).
(2) the two P1 and P2 plate barcodes added to the Illumina adapters that are, in combination, unique to a batch (the list of sequences we used is available at the materials section). Any index compatible with illumina technology could be used, such as NEBNext Multiplex Oligos for Illumina (Cat.#: E7395S).

Control samples
Including one negative control (i.e. empty well) randomly located in each plate allows to easily identify possible technical errors (e.g. 96-well plate switch).
Including technical replicates (i.e. include twice the same DNA sample with different barcodes) allows to estimate genotyping error rate.
Materials

Equipments


Equipment
Bioruptor Pico sonication device
NAME
Sonicator
TYPE
Diagenode
BRAND
B01060010
SKU

Equipment
ThermoMixer
NAME
Shaking and temperature incubator
TYPE
Eppendorf
BRAND
ThermoMixer C F2.0
SKU
220 – 240 V/50 – 60 Hz (EU)
SPECIFICATIONS

Equipment
Mini-Centrifuge
NAME
Centrifuge
TYPE
Fisherbrand
BRAND
16617645
SKU
100-240V, 50/60Hz
SPECIFICATIONS


Equipment
Universal 320
NAME
Plate centrifuge
TYPE
Hettich
BRAND
1401/HET
SKU
LINK
RPM MAX.: 16.000 min-1 POIDS: env. 31 kg | 52 kg REFROIDISSEMENT: ventilé
SPECIFICATIONS

Equipment
Swing-out Rotor, 2- Places
NAME
Rotor
TYPE
Hettich
BRAND
1460/HET
SKU
LINK
max capacity 10 plates
SPECIFICATIONS


Equipment
Vortex-Genie 2
NAME
Vortex
TYPE
Scientific Industries
BRAND
15547335
SKU

Equipment
Mastercycler
NAME
Thermocycler
TYPE
Eppendorf
BRAND
6332000010
SKU

Equipment
Bioanalyzer
NAME
Nanofluidic electrophoresis system
TYPE
Agilent
BRAND
G2991AA
SKU

Equipment
Qubit Fluorometer
NAME
Fluorometer
TYPE
Invitrogen
BRAND
Q33238
SKU
LINK

Equipment
DynaMag-2
NAME
Magnet
TYPE
Invitrogen
BRAND
12321D
SKU
LINK



Equipment
Proline Pipette Pack
NAME
Pipette Pack
TYPE
Sartorius
BRAND
15673094
SKU
LINK
Includes: 4 x Single-channel pipets (0.5 to 10μL, 10 to 100μL, 20 to 200μL, 100 to 1000μL), Tip Racks to 96 tips (0.1 to 10μL, 0.5 to 200μL, 10 to 1000μL), 1 x Linear Stand and 4 x Pipet Holders
SPECIFICATIONS

Equipment
Multipette® M4
NAME
Mechanical multi-dispenser pipette
TYPE
Eppendorf
BRAND
4982000012
SKU
LINK
1 canal 1 µL – 10 mL
SPECIFICATIONS


Supplies

  • Filter tips (compatible with pipettes)
  • Combitips advanced 0.1 mL (Eppendorf #0030089405)
  • PCR plate (Thermo Scientific #AB0600)
  • PCR Transparent adhesive film (4TITUDE #4TI-0500)
  • Aluminium adhesive film (Axygen #PCR-AS-200)
  • DNA LoBind Tubes (Eppendorf #0030108051)
  • 0.65 ml Bioruptor Pico Microtubes (Diagenode #C30010011)


Reagents


Nuclease-Free Water
Buffer EBQiagenCatalog #19086
PstI (100,000 units/ml) - 50,000 unitsNew England BiolabsCatalog #R0140M
SbfI-HF - 2,500 unitsNew England BiolabsCatalog #R3642L
NEBuffer 4 - 5.0 mlNew England BiolabsCatalog #B7004S
NEBuffer 2 - 5.0 mlNew England BiolabsCatalog #B7002S
ATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441 Quick LigaseNew England BiolabsCatalog #M0202
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Ethanol 100%
Dynabeads M-280 StreptavidinThermo Fisher ScientificCatalog #11205D
1M Tris-HClThermo ScientificCatalog #J22638
0.5M EDTAInvitrogen - Thermo FisherCatalog #AM9261
5M NaClInvitrogen - Thermo FisherCatalog #AM9759


Well barcode adapters

Duplex with /5Biosg/ and /5Phos/ modificationsIntegrated DNA Technologies, Inc. (IDT)Catalog #100 nmole Duplex

Well barcodes are composed of a duplex of two oligos:
Top oligo (well barcode in bold):
/5Biosg/GTACGTCCTGCAGGXXXXXXXXTGCA
Bottom oligo (well barcode in bold):
/5Phos/XXXXXXXXCCTGCAGGACGTAC

The list of well barcode sequences is available in the Supplementary data FileS1, "New RAD" table (https://doi.org/10.1534/genetics.115.183665)

Plate barcode adapters

P1 adapters plate barcodes are composed of a duplex of two oligos:
Top oligo (Illumina Universal Adapter + plate barcode in bold):
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXX*T
Bottom oligo (plate barcode in bold + Illumina Universal Adapter):
/5Phos/XXXXXAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT*T

P2 adapters plate barcodes are composed of a duplex of two oligos:
Top oligo (plate barcode in bold + Illumina Universal Adapter):
/5Phos/XXXXXAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCAGAACAA
Bottom oligo (Illumina Universal Adapter + plate barcode in bold):
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXXXX*T

List of 16 P1 plate barcode sequences :
AAGTG
ACAAT
CTAGA
GATAG
GCCTC
TGTGT
GTATT
CGGAC
AAACAA
ACGTCA
CGTCTC
CCCAAA
GTTCGG
TGCCCA
TTGGGC
TACGAG

List of 8 P2 plate barcode sequences :
ACCTA
TAGGTC
CGTAC
GTACGA
AGTCA
GACTCG
CCGAT
TTAGGC

Kits


Agilent High Sensitivity DNA KitAgilent TechnologiesCatalog #5067-4626
Qubit® dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854
NEBNext Ultra II DNA Library Prep Kit for IlluminaNew England BiolabsCatalog #E7645L
KAPA Library Quanitification KitsRocheCatalog #07960140001

Before start
DNA quality control
Beforehand, DNA quality should be checked with an electrophoresis on an agarose gel.

Measurement of DNA quantity
Beforehand, the amount of genomic DNA should be determined with a fluorescent method (as Qubit assay) in order to be normalized.

Sample metadata
Prepare a metadata file containing for each sample, a unique ID and the combination of the three barcodes used. This allows to avoid switching barcodes during the sample pooling and is required for sequence read demultiplexing.
Part I - Genomic DNA restriction, well barcode ligation, pooling and shearing
7h 50m
Genomic DNA enzymatic restriction
3h
In a 96-well microplate, normalize the DNA concentration of each DNA sample in a final volume of 10µL using EB buffer.


Note
Ideally, use a total DNA quantity (i.e. for the batch of samples to be pooled) around 2000ng (e.g. 96 samples x 2ng/µL x 10µL, or 24 samples x 8ng/µL x 10µL).

At minimum, use a total DNA quantity of 700ng. We validated this minimal input DNA quantity by sequencing a library constructed from an input of 672ng.

It is possible to use a larger input DNA quantity, which allows a more reliable normalization. In this case, it is necessary in step 3 to use a volume that corresponds to around 2000ng. This also allows to keep the remaining volume in step 3 as a back-up.

It is possible to apply the protocol in parallel on several plates.

1h
Into a 1.5 ml low bind tube on a cold block, prepare the master mix of enzymatic restriction (vols for 1 rxn) :

0.55 µL H2O
1.2 µL NEB buffer 4 10X
0.25 µL SbfI or PstI


  1. Gently vortex and centrifuge the mix.
  2. Using a new plate on a cold block, a Multipette and a 0.5mL Combitip, distribute 2 µL of mix into each well.
  3. Using P10 multichannel pipet, add 10 µL of normalized DNA.
  4. Close the plate with self-adhesive film.
  5. Vortex and centrifuge.
30m

Apply the following restriction program using a thermocycler (heated lid on):

37 °C 1h
80 °C 20min
10 °C hold

1h 30m
Ligation of well barcodes

1h 30m
Into a 1.5 ml low bind tube, prepare the ligation master mix (vols for 1 rxn) :


1.19 µL H2O
0.4 µL NEB buffer 2 10X
0.16 µL rATP 100mM
0.25 µL Quick ligase


  1. Gently vortex the mix and centrifuge.
  2. Using a new plate on a cold block, a Multipette and a 0.5mL Combitip, distribute 2 µL of mix into each well.
  3. Using P10 multichannel pipet, add 12 µL of digested DNA
  4. Using P10 multichannel pipet, add 2 µL of well barcodes (0.05µM if SbfI digestion or 1µM if PstI) according to the plate plan.
  5. Close the plate with self-adhesive film
  6. Gently vortex and centrifuge
40m
Apply the following ligation program using a thermocycler (heated lid on):


22 °C 30min
65 °C 10min (decrease the temperature slowly to 65 at 25°C, e.g. 2.7°C/min during 15min using the minimum ramp speed)
25 °C hold

50m
Pooling, purification and concentration
1h 20m
Sample pooling

Note
Choose the volume to be pooled according to the amount of DNA input and the number of samples. Total DNA quantity in the pool should be at least 700ng, and ideally 2000ng.
  1. Using a multichannel pipet, pool each barcoded sample of a same batch and a same row of a plate in a 0.2mL 8-tubes PCR strip.
  2. Transfer all the samples of a batch, i.e. all the volume of the 8-tubes PCR strip, in a 1.5mL low-bind tube.
30m
Purification and concentration on AMpure beads (ratio 1X)

Incubate AMpure beads at room temperature at least 00:30:00 .
Prepare 70% ethanol :
For one pool: 954 µL H2O +2000 µL Absolute Ethanol .


  1. Measure the exact volume of the pool
  2. Add an equivalent volume of AMpure beads and vortex
  3. Incubate00:05:00 at room temperature
  4. Place on a magnetic holder for 00:05:00 .
  5. Without removing the tube from the magnetic holder, remove supernatant, add 1000 µL 70% ethanol , incubate 00:00:30 and discard the supernatant.
  6. Repeat step 5 one time
  7. Let dry on the magnetic holder for 00:08:00 .
  8. Re-suspend in 100 µL EB buffer (or in 102µL to do the optional 4.2 step)
  9. Remove from the magnetic holder and vortex gently
  10. Incubate 00:02:00 at room temperature
  11. Centrifuge briefly and place on a magnetic holder for 00:05:00 .
  12. Transfer 100 µL ( or 102µL for the optional 4.2 step) to Diagenode tubes for shearing
Vortex and centrifuge.

50m
Shearing

Maintain tubes at 4°C if shearing is planned within 24 hours or freeze.

2h


  1. Briefly vortex and centrifuge the tubes (maximum 12 tubes in parallel, i.e. 12 batches of 96 samples)
  2. Check that there are no bubbles and place the tubes in the rotor (12 tubes of 0.5mL).
  3. Place the rotor in the bath.
  4. Run the following shearing program:
Four cycles of :
00:00:30 ON
00:01:30 OFF

Repeat the four previous steps one more time (for a total of 8 shearing cycles or a different total number of cycles, see note 4.2).
1h
Quality and quantity control (optional)

Run 1 µL of each pool on an Agilent High Sensitivity (HS) chip (following manufacturer protocol).
Note
The desired fragment size profile depends on the sequencing read length. For a paired-end sequencing of 150 bp, the profile is expected to be centered around 350bp (200-500bp).

The size of the fragments obtained may depend on the biological model and the quality of the DNA input. It is cautious to test different numbers of fragmentation cycles in the bioruptor to adapt the shearing program to the experiment. The higher the number of cycles, the shorter the fragments.

Run 1 µL of each pool on a Qubit High Sensitivity (HS) assay (following manufacturer protocol).
Note
At this step, the amount of DNA should be between 350ng and 1500ng. A DNA loss of about 25-50% is expected and mostly due to AMpure purification. The more degraded the input DNA, the larger the loss.

1h
Part II - Selection of fragments carrying the restriction site
4h
Preparation of Dynabead M-280 magnetic streptavidin beads

Since streptavidin beads adhere to tips, re-suspend by vortexing and not by pipetting.

Incubate the streptavidin beads at room temperature for at least 00:30:00 before using it.


  1. For each pool, prepare 1 mL 2X Binding and Wash buffer (B&W 2X):
10 millimolar (mM) Tris-HCl (pH 8.0)
1 millimolar (mM) EDTA pH 8.0
2 Mass Percent NaCl

  1. For each pool, transfer 30 µL of Dynabeads into a new 1.5mL low bind tube.
  2. Place the tube on a magnetic holder and discard the supernatant.
  3. Without removing the tube from the magnetic holder, add 100 µL B&W 2X
  4. Remove the tube from the magnetic holder, vortex 00:00:30 , centrifuge briefly.
  5. Place the tube on the magnetic holder for 00:01:00 and discard the supernatant.
  6. Repeat steps 3 to 5 twice for a total of 3 washes.
  7. Re-suspend beads in 100 µL B&W 2X .
40m
Binding DNA to beads
1h 50m
  1. Add shared DNA (~100µL) to the prepared beads.
  2. Briefly vortex and centrifuge the tubes.
  3. Apply the following binding program in a thermomixer:

22 °C 20min
900 rpm 15s every 2min
30m
For each pool:
  1. Prepare B&W 1X: 250 µL B&W 2X + 250 µL H2O . Incubate at Room temperature
  2. Pepare B&W 1X: 175 µL B&W 2X + 175 µL H2O . Incubate at 56 °C in a thermomixer.
  3. Prepare NEB buffer 4 1X: 30 µL NEB buffer 4 10X + 270 µL H2O . Incubate at Room temperature .
20m
  1. Centrifuge briefly and transfer each pool in a 1.5mL low bind tube.
  2. Place tubes on a magnetic holder for 00:01:00 and discard the supernatant.
  3. Re-suspend the beads with 150 µL 1X B&W at Room temperature .
  4. Vortex gently and centrifuge briefly.
  5. Place the tube on the magnetic holder for 00:01:00 and discard the supernatant.
  6. Repeat steps 3 to 5 twice with B&W 1X buffer at Room temperature for a total of 3 washes.
  7. Repeat steps 3 to 5 twice more with buffer B&W 1X at 56 °C for a total of 5 washes.
1h
Release DNA from streptavidin beads

  1. Re-suspend the beads in 100 µL NEB buffer 4 1X .
  2. Remove the tube from the magnetic holder, vortex gently and centrifuge briefly
  3. Place the tube on the magnetic holder for 00:01:00 and discard the supernatant.
  4. Repeat step 1 to 3 for a total of 2 washes.
  5. Re-suspend the beads in 40 µL NEB buffer 4 1X .
  6. Remove the tube from the magnetic holder, vortex gently and centrifuge briefly.
  7. Add 2 µL SbfI-HF .
  8. Vortex gently.
  9. Run the following release program in a thermomixer:

37 °C 60min
600 rpm 30s every 6 min

  1. Vortex gently and centrifuge briefly.
  2. Place the tube on the magnetic rack for 00:01:00 .
  3. Transfer 40 µL supernatant in a 1.5mL low bind tube.

20m
Purification on AMpure beads (1X)

Incubate AMpure beads at room temperature at least 00:30:00 .
Prepare 70% ethanol :
For one pool: 133 µL H2O +467 µL Absolute Ethanol .


  1. Add 40 µL of AMpure beads to each pool.
  2. Incubate00:05:00 at room temperature
  3. Place on a magnetic holder for 00:05:00 .
  4. Without removing the tube from the magnetic holder, remove supernatant, add 200 µL 70% ethanol , incubate 00:00:30 and discard the supernatant.
  5. Repeat step 5 one time
  6. Let dry on the magnetic support for 00:08:00 .
  7. Re-suspend in 51 µL EB buffer (or 52µL for the optional step 9)
  8. Remove from the magnetic holder and vortex gently
  9. Incubate 00:02:00 at room temperature
  10. Centrifuge briefly and place on magnetic holder for 00:05:00 .
  11. Transfer 50 µL (or 51µL for the optional step 9) to a 0.2mL PCR tube.
  12. Vortex and centrifuge.
50m
Quantity control (optional)


Run 1 µL of each pool on a Qubit HS assay (following manufacturer protocol).
Note
At this step, the amount of DNA should be between 8ng and 30ng.
The large loss of DNA is expected and mainly due to step 6, in which the fragments of interest (which carry the restriction site) are bound to the streptavidin beads, while the rest of the genome is washed out.

20m
Part III - Library construction with NEBNext Ultra II kit
8h 30m

Note
The following steps are described in the NEB Next Ultra II kit's manual, except for two modifications concerning the AMpure purification ratios (see steps 12 and 15) and several recommendations (see notes and optional quality controls).
NEBNext End Prep

Directly into the 50 µL from step 8, add :

3 µL NEBNext Ultra II End Prep Enzyme Mix
7 µL NEBNext Ultra II End Prep Reaction Buffer

  1. Vortex gently and centrifuge briefly (It is important to mix well. The presence of a small amount of bubbles will not interfere with performance)
  2. Place in a thermocycler, with the heated lid set to ≥ 75°C
  3. Run the following program:

20 °C 30min
65 °C 30min
4 °C hold

Warning: move to the next step immediately.

1h 20m
Plate barcode adapter Ligation


Directly into the 60 µL from step 10, on a cold block, add in order:

30 µL NEBNext Ultra II Ligation Master Mix
1 µL NEBNext Ligation Enhancer
1.25 µL P1 adapters 1.5 micromolar (µM)
1.25 µL P2 adapters 1.5 micromolar (µM)

  1. Vortex gently and centrifuge briefly (It is important to mix well. The presence of a small amount of bubbles will not interfere with performance)
  2. Place in a thermocycler, with the heated lid off
  3. Run the following program:

20 °C 15min
10 °C hold

Samples can be stored overnight at –20°C.
40m
Cleanup of Adaptor-ligated DNA (ratio 0.65X)

Note
The ratio recommended in the supplier manual is 0.9X. We suggest a more drastic library sizing with 0.65X ratio, which we have found to be the best for removing free adapters.

Incubate AMpure beads at room temperature at least 00:30:00 .
Prepare 70% ethanol :
For one pool: 133 µL H2O +467 µL Absolute Ethanol .

  1. Transfer 93.5 µL from step 11 in a 1.5mL low-bind tube.
  2. Add 61 µL Ampure beads
  3. Incubate00:05:00 at room temperature
  4. Place on magnetic holder for 00:05:00 .
  5. Without removing the tube from the magnetic holder, remove supernatant, add 200 µL 70% ethanol , incubate 00:00:30 and discard the supernatant.
  6. Repeat step 5 one time.
  7. Let dry on the magnetic support for 00:08:00 .
  8. Re-suspend in 51 µL EB buffer (52µL for the optional step 13).
  9. Remove from the magnetic holder and vortex gently.
  10. Incubate 00:02:00 at room temperature.
  11. Centrifuge briefly and place on magnetic holder for 00:05:00 .
  12. Transfer 17 µL (18µL for the optional step 13) to a 0.2mL PCR tube.
  13. Vortex and centrifuge.
55m 30s
Quantity control (optional)


Run 1 µL of each pool on a Qubit HS assay (following manufacturer protocol).
Note
The amount of DNA is expected to be the same or slightly lower as in step 9. If the quantity is significantly lower as in the step 9 (loss of more than 20%), you could go back with the remaining DNA from step 3 if available.

20m
Final PCR enrichment


Note
The number of final enrichment cycles depends on the quality and quantity of the input DNA (i.e. step 10 of this protocol) and also on the final quantity of library desired depending of the sequencing platform and flowcell format used. For a standard application (Illumina sequencing, which may require around 100ng of library), the NEBNext Ultra II manual recommends 6-7 cycles for 10-30ng of input DNA. For applications requiring a larger library quantity (e.g. RAD-capture by probe hybridization, which may require around 300ng of library), it is recommended to increase the number of cycles (otherwise, it comes with the risk of increasing the rate of PCR duplicates).

We tested 6, 9 and 12 PCR cycles for 12ng of NEB input DNA and found an optimal amplification with 9 cycles (i.e. 105ng and 11nM of library for an Illumina NovaSeq sequencing). Furthermore, 9 cycles led to good sequencing results for several libraries constructed from a range of 8-30ng of input DNA.

Into a PCR tube, prepare PCR master mix (vols for 1 rxn) :
25 µL NEBNext Ultra II Q5 Master Mix
5 µL RAD Lib F 10 micromolar (µM)
5 µL RAD Lib R 10 micromolar (µM)

15 µL library

  1. Vortex gently and centrifuge briefly
  2. Place in a thermocycler, with the heated lid on, and run the following program:

98 °C 30s

6-12 cycles of :
98 °C 10s
65 °C 1m15s

65 °C 5m
10 °C hold
1h 30m
Cleanup of amplified library (ratio 0.65X)


Note
The ratio recommended in the supplier manual is 0.9X. We suggest a more drastic library sizing with 0.65X ratio, which we have found to be the best for removing free adapters.
Incubate AMpure beads at room temperature at least 00:30:00 .
Prepare 70% ethanol :
For one pool: 133 µL H2O +467 µL Absolute Ethanol .

  1. Verify the 50 µL from step 13 and transfert in a new low bind tube.
  2. Add 32.5 µL Ampure beads
  3. Place on a magnetic holder for 00:05:00 .
  4. Without removing the tube from the magnetic holder, remove supernatant, add 200 µL 70% ethanol , incubate 00:00:30 and discard the supernatant.
  5. Repeat step 4 one time
  6. Let dry on the magnetic support for 00:08:00 .
  7. Re-suspend in 22 µL EB buffer
  8. Remove from the magnetic holder and vortex gently
  9. Incubate 00:02:00 at room temperature
  10. Centrifuge briefly and place on magnetic holder for 00:05:00 .
  11. Transfer 21 µL to a 0.2mL PCR tube.
  12. Vortex and centrifuge.
50m
Final quality controls

Run 1 µL of each library on a Qubit HS assay (following manufacturer protocol).
Note
At this step, the amount of DNA should be 3-10 times higher than in step 13.

Run 1 µL of each library on an Agilent HS chip (following manufacturer protocol).
Note
Calculate the average size of the fragments. It should be around 120bp more than the average of the sheared DNA fragments (see Step 4.2).


Profile of a high-quality library on an Agilent HS chip (NEB input of 12ng, 0.65X AMpure purifications, 9 PCR cycles, final library of 180ng). Fragment sizes are tightly centered around the mean (534 bp), without unexpectedly large fragments.

Profile of two over-amplified libraries with free adapters on an Agilent HS chip (NEB input 50ng, 0.9X AMpure purifications, 12 PCR cycles). Low molecular weight peaks form a scale pattern. Over-amplification is visible around 6000bp.
Unexpectedly low molecular weight peaks (about 120bp, 240bp) are likely free adapters and adapter doublets. If peak heights are relatively elevated, the amount of adapters used was too large and/or the AMpure purification from step 12 and 15 was not efficient enough. You can apply once more cleanup of step 15 in order to attempt to remove this unexpected peaks.

Unexpectedly high molecular weight peaks (e.g., above 6000bp) are likely artificial concatenation, i.e. artifact sequences formed by two or more biological sequences. These fragments are caused by over-amplification in step 14, because of a too large number of cycles. Over-amplification will also produce more PCR duplicates. See the note of step 14 to optimize the number of PCR cycles.
Small fragments are favored by Illumina sequencing. Thus, unexpected low molecular weight peaks are more problematic than high ones.


Run 2 µL of each library on a Kapa assay (following manufacturer protocol).
Note
At this step, the concentration should ideally reach a minimum of 10nM. However, when input DNA is of low quality or quantity, 2nM may be sufficient (depending on the sequencing facility).

KAPA library concentration can be used to normalize several batches of samples aimed to be pooled altogether before Illumina sequencing. Don't use concentration values obtained by a Qubit assay, because it represents all DNA fragments and not only those with both Illumina adapters which will be sequenced.



3h
Protocol references
Ali, O. A., Jeffres, C., & Miller, M. R. (2016). RAD Capture (Rapture): Flexible and Efficient Sequence-Based Genotyping. Genetics, 202(2), 16. https://doi.org/10.1534/genetics.115.183665

Baird, N. A., Etter, P. D., Atwood, T. S., Currey, M. C., Shiver, A. L., Lewis, Z. A., Selker, E. U., Cresko, W. A., & Johnson, E. A. (2008). Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers. PLOS ONE, 3(10), e3376. https://doi.org/10.1371/journal.pone.0003376