Dec 29, 2025

Public workspaceA 38-plex PCR MALDI-TOF MS-based assay to detect SNPs common in elite athletes

Peer-reviewed method
  • Miftahul Zannah1,
  • Ioannis Papadimitriou2
  • 1Graduate Program in Molecular Medicine, Faculty of Science, Mahidol University, Bangkok, Thailand;
  • 2Department of Physiology, Faculty of Science, Mahidol University, Bangkok, Thailand
  • Ioannis Papadimitriou: Corresponding author;
Icon indicating open access to content
QR code linking to this content
Protocol CitationMiftahul Zannah, Ioannis Papadimitriou 2025. A 38-plex PCR MALDI-TOF MS-based assay to detect SNPs common in elite athletes. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly4b5elx9/v1
Manuscript citation:
Zannah M, Papadimitriou I (2025) A 38-plex PCR MALDI-TOF MS-based assay to detect SNPs common in elite athletes. PLOS One 20(12). doi: 10.1371/journal.pone.0339384
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 02, 2025
Last Modified: December 29, 2025
Protocol Integer ID: 231971
Keywords: DNA isolation, Amplification, Dephosphorylation, snps common in elite athlete, high prevalence among elite power athlete, elite power athlete, athletic performance, elite athlete, elite athletic status, prevalent in elite athlete, targeted snp, specific physical fitness characteristic, influence on specific physical fitness characteristic, multiple such snps with the aim, multiple such snp, muscle power, muscle power production, potential influence on muscle power production, physical fitness, such as muscle power, snp, speed gene study, nucleotide polymorphism, specificity of multiplex pcr, plex pcr amplification, exploring genetic factor, various sport, multiplex pcr amplification, suitability for multiplex pcr amplification, strength, flight mass spectrometry, genetic factor, endurance, wide association study
Funders Acknowledgements:
All chemical consumables for this study were covered by Faculty of Science Mahidol University and corresponding author’s Early Career Research Grand A35/2562.
Grant ID: A35/2562
Abstract
There is great demand for a novel technique to facilitate the rapid identification of multiple single-nucleotide polymorphisms (SNPs) prevalent in elite athletes. Case-control and genome-wide association studies (GWAS) have been conducted to investigate an individual’s likelihood for success in various sports, revealing several putative loci associated with elite athletic status. However, it remains challenging to simultaneously detect multiple such SNPs with the aim of examining their influence on specific physical fitness characteristics, such as muscle power, strength or endurance. Here we developed a 38-plex PCR amplification assay, integrated with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), for the identification of 38 SNPs linked to elite athletic performance within a single 38-plex reaction. The SNPs were chosen based on their high prevalence among elite power athletes, potential influence on muscle power production, and suitability for multiplex PCR amplification. The developed protocol simultaneously detected the targeted SNPs in a single tube, using a minimum DNA concentration of 10 ng/μL and achieving a total sample call rate of 93.13%. With further research this new protocol—which integrates the specificity of multiplex PCR and the sensitivity of MALDI-TOF MS—may offer a unique opportunity to deepen our understanding of the genetic basis of physical fitness and may have prospective applications in research initiatives exploring genetic factors that influence athletic performance, e.g. the Speed Gene Study [1].
Guidelines
With further research this protocol can be used for generic profiling of elite athletes.
Troubleshooting
Step 1: The DNA isolation
37m
Collect the blood (Amount200 µL ) duals using spring loaded lancets with glass capillary tubes and store in EDTA tubes at Temperature5 °C for a maximum of 3 days prior to DNA extraction.

Pipetting
Temperature
Extract the DNA from white blood cells utilizing bead-based DNA separation methods with the Sbeadex™ blood DNA Kit (Biosearch Technologies, Germany) as described below.

The magnetic rack and the kit were used for the DNA extractions.

Initially, add 1x volume of Lysis Buffer to Amount200 µL of fingertip blood, followed by the addition of 0.2x volumes of Protease K solution.

Pipetting
Thereafter incubate the samples at Temperature55 °C for Duration00:20:00 with constant shaking.

20m
Incubation
Temperature
Allow the samples to cool briefly to TemperatureRoom temperature , after which add 1.8x the volume of Binding Buffer containing Sbeadex™ magnetic particles. Upon completion of this step, incubate the samples for Duration00:05:00 with continuous agitation and place into a magnetic rack, ensuring close proximity to the magnets.

5m
Incubation
Pipetting
Temperature
Subsequent to this step, discard the supernatant, remove the Eppendorf tube from the magnetic rack, and add 4x volume of Wash Buffer 1 to the sample, followed by Duration00:05:00 -Duration00:10:00 incubation with constant shaking.

10m
Incubation
Pipetting
After that, reposition the tube in the magnetic rack, ensuring close proximity to the magnets for approximately Duration00:02:00 .

2m
Then discard the supernatant, and remove the samples from the magnetic rack. This procedure was subsequently conducted once with the inclusion of Wash Buffer 1 & RNase solution, and once more with the addition of Wash Buffer 2.

Finally, add 0.25x-1x volume of Elution Buffer to the sample, which was then returned to the magnetic rack.

Pipetting
Meticulously transfer the elute to a new Eppendorf tube via pipetting, ensuring that all Sbeadex™ beads remained in the original tube.

Pipetting
Evaluate the quality of extracted DNA using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Massachusetts, United States). Choose the samples with an OD260/280 ratio ranging from 1.8 to 2.0 and an OD260/230 ratio within the range of 2.0 to 2.2 for the subsequent experiments.

The Nanodrop Spectrophotometer used for the experiment.

Step 2: Primer design
The primer design included obtaining a considerable amount of DNA sequences for every targeted locus from the NCBI genome database.

Subsequently align the DNA sequences using the CLUSTAL-W alignment software [2] to pinpoint highly conserved areas for primer design with the Assay Design 4.0 program (Agena Bioscience, Inc., California, United States).

The 104 primers synthesized and used in the experiment.

Enter all targeted gene sequences into the program, adhering to the manufacturer's guidelines. Moreover, the primer design method followed rigorous criteria to reduce primer-dimer formation, hairpin loops, and non-specific priming, hence guaranteeing the synthesis of excellent quality primers.

Furthermore, assess the specificity of the synthesized primers using the BLAST (Basic Local Alignment Search Tool) software to verify optimal primer specificity. Choose only primers demonstrating the maximum specificity for the multiplex PCR based protocol developed in this study.

It is essential to note here that manual modifications, including base alterations and primer sequence changes, were carried out when required to attain uniformity in guanine-cytosine content (%GC) values and melting temperature (Tm) among multiplex primers, hence optimizing PCR amplification protocol.

Synthesize all primers by Macrogen, Inc. in Seoul, Korea and their sequences are shown in Table 1.

ABCD
Targeted SNPsForward Primer SequenceReverse Primer SequenceExtended Primer Sequence
rs10186876ACGTTGGATGGATCTCCAGGAGAGAATGTGACGTTGGATGTTCCCCAGGAGCTTGTTTTCaaacTGTGGAGGAAAGTAGA
rs11091046ACGTTGGATGGGATTATTCAGGCTTTAGGCACGTTGGATGCCTCCACTCAAGTGAAATGCAGGAATATAATTTATAGC
rs1137070ACGTTGGATGCTTAAATGGTCTCGGGAAGGACGTTGGATGCCAGAGTCACCAAACTTACCtGGTGACCGAGAAAGA
rs11549465ACGTTGGATGCTTCCAGTTAC GTTCCTTCGACGTTGGATGCTTTGAGGACTTGCGCTTTCTCGATCAGTTGTCA        
rs12778366ACGTTGGATGGCTAAGGTCCTATCTACATCACGTTGGATGTAAGGCTTCTAGGACTGGAGTCTTATTTCATCTGGTCACCACT
rs13135092ACGTTGGATGCCGTCACATAAACAGAACCACGTTGGATGTTAGCTTGAAAGGGTGTTGggacGGGTGTTGAATTTTA
rs143384ACGTTGGATGCGCTGAATGACACCAAAGAGACGTTGGATGCCTTTCATGGTTTTTCCTGCACCAGAGGCACCTT
rs17602729ACGTTGGATGCTGACAAATGGCAGCAAAAGACGTTGGATGGCCACCATGATTACAGAAAGgttaATACAGCTGAAGAGAAA
rs1801131ACGTTGGATGCCGAGAGGTAAAGAACGAAGACGTTGGATGTCTACCTGAAGAGCAAGTCCggGACTTCAAAGACACTT
rs1801282ACGTTGGATGGTTATGGGTGAAACTCTGGGACGTTGGATGGTTTGCAGACAGTGTATCAGGGAGATTCTCCTATTGAC
rs1805065ACGTTGGATGTCCAGGTGCCTTCTTGATCCACGTTGGATGCCAGCTCCATGTAGAACAGCTTGATCCCGTACA
rs1805086ACGTTGGATGGACGGGTCTCAAATATATCCACGTTGGATGGTGGATGGAAAACCCAAATGagACAATACAATAAAGTAGTAA
rs1815739ACGTTGGATGCGATCAGTTCAAGGCAACACACGTTGGATGCAGATCTTCTGGATCTCACCgACTGCCCGAGGCTGAC
rs2070744ACGTTGGATGACTGTAGTTTCCCTAGTCCCACGTTGGATGAGGTCAGCAGAGAGACTAGGCAAGCTCTTCCCTGGC
rs2275998ACGTTGGATGCTACGTTATTACACCGACGCACGTTGGATGAAGCCTCATCTGCTAAGGTGgcgtCCTAGCTCGTCCTAGGG
rs2290463ACGTTGGATGAAGGTGGAGGTAAGGGCTGACGTTGGATGAGCATGAGGGCTCCCAACTccccTCCCCCCAGGTTGGA
rs2439823ACGTTGGATGTAAGTGAGTGACAGGGAAGGACGTTGGATGAGACTATCTCACCTTTCAGCACCTTTCAGCTCTCTA
rs2854464ACGTTGGATGGAATCCTGGTGGAAGTCTTGACGTTGGATGGATGCTGCTGAGGATGATGGGCTGGCTCATTTCCCA
rs2920503ACGTTGGATGCTCAGTGGGTTTTTCGAACACGTTGGATGTTCTGGGACATTTTAATGGcTTAATCTTGATTATATTCAA
rs303760ACGTTGGATGTCTTCGATGAGGCCAACAAGACGTTGGATGGACAGGACAGGAGGGGACGggtaGCGCGGGACCGGCCTTGGC
rs3213537ACGTTGGATGAAGAGGCCAGAGAGTATGAGACGTTGGATGGGGAGGAGAGAGCTTTTAAGATGAGGGTCATGGT
rs3758391ACGTTGGATGGCCATAACAAACACTGGCTCACGTTGGATGGCACACTGTGACTCCATATCCAAACACTGGCTCTAGATCTACCA
rs4074992ACGTTGGATGTCATCGTCATGACCACCAGACGTTGGATGTTGGGCAGCCGAAGATGCACttggGCGGTGCCAGTGCTC
rs41274853ACGTTGGATGTCTTTGGTGGGTGGGTTAGACGTTGGATGGACACAATTTGTGGAGACCCcGCCGCCCCCCAGCCCTG
rs4253778ACGTTGGATGGGTGGAACACTTGAAGCTTGACGTTGGATGTTCTGGAGATCACAACCACCttttAAGCTTGATATCTAGTTT
rs4734621ACGTTGGATGACCACCACACACAGCTAATCACGTTGGATGCAGCCTGGGCATTATAGTGTGTTTATTTTTTTGTAGAAA
rs55743914ACGTTGGATGACTTTCTTTCTTACTCTGCACGTTGGATGGTCAAGGCTCGTAAAGTCAGgTTCTTACTCTGCATACAG
rs558129ACGTTGGATGGATCTTAAAATGCAGAGGTCACGTTGGATGATTCCCCAGTGTGTCTTTTGcttaCCTAAATTCAATCACAA
rs56068671ACGTTGGATGCAGAAAGAGATATACTGTGGACGTTGGATGTTCTTGGTGAATTGACTCCGGAAAATTAAGCTAAG
rs671ACGTTGGATGAGGTCCCACACTCACAGTTTACGTTGGATGCCTTTGGTGGCTACAAGATGCCCACACTCACAGTTTTCACTT
rs680ACGTTGGATGAAATTCCCGTGAGAAGGGAGACGTTGGATGTCCCTGAACCAGCAAAGAGAAGAGAAAAGAAGG
rs6905419ACGTTGGATGTATCGCCCAGGCTGGAATGACGTTGGATGAGGCTGAAGCAGGAGAATGATCTCGGCTCACTG
rs699ACGTTGGATGGTGGACGTAGGTGTTGAAAGACGTTGGATGCTGTGACAGGATGGAAGACgGGAAGACTGGCTGCTCCCTGA
rs699785ACGTTGGATGGAGTGCAATGGTGCAATCTCACGTTGGATGTAATCCTGGCTACTTGGGAGcttCTCATCGCAAACTCC
rs7247312ACGTTGGATGAGATCACACCACTGCACTCACGTTGGATGCAAAGTGGGTCAACTGGAACctccTTTTCTGTCTCTTTTT
rs7832552ACGTTGGATGGCCTTGACCTCAAAGGAATGACGTTGGATGACAACAAGAGTCAAGCACCCGATAGTGTGAGGTA
rs8111989ACGTTGGATGAGCTTTCTAGGAGAAATGGGACGTTGGATGCTGACTTCATCCCTCTGTAGaagTTCTCAAGAACCTGCC
rs9320823ACGTTGGATGCTTGGGTGGCTTCAAACTACACGTTGGATGAGAAATGAGGGAGATAAGGGttGCCTTTTTCTGTCATGAA
Table 1. The PCR primers (forward, reverse and extension) sequence of 38 SNPs linked to athletic success in power-related sports.
Step 3: The initial PCR
9m
The initial Amount5 µL PCR reaction mix contained Amount0.50 µL PCR Buffer, Amount0.40 µL MgCl2, Amount0.10 µL dNTPs and 0.20 PCR Enzyme  (Agena Bioscience, California, United States), Amount1 µL of primer mixture yielding a final concentration of Concentration500 nanomolar (nM) for each forward and reverse primer, Amount2.0 µL of DNA template, and Amount0.80 µL of DNase-free distilled water.

The dNTPs, polymerase and other reagents used for the first reaction.

Pipetting
PCR
Perform the multiplex PCR amplification assay with a MiniAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) in our laboratory at Faculty of Science, Mahidol University.

The MiniAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) used for the experiment.

The PCR involved a denaturation at Temperature95 °C for Duration00:02:00 , followed by 45 cycles of denaturation at Temperature95 °C for Duration00:00:30 , annealing at Temperature55 °C for Duration00:00:30 , extension at Temperature72 °C for Duration00:01:00 , and a final extension at Temperature72 °C for Duration00:05:00 as shown in Table 2.
ABCDE
PCR ReactionVolume reactionTemperatureTimeCycles
Stage 1 5 µl95 °C2 minutes1
Stage 295 °C30 seconds45
56 °C30 seconds
72 °C1 minutes
Stage 372 °C5 minutes1
4 °C Hold
Table 2. The initial multiplex PCR conditions and reaction volume.
9m
PCR
Temperature
Finally terminate the initial PCR reaction by reducing the temperature at Temperature4 °C to end the amplification process.

Temperature
Step 4: The SAP reaction
45m
After the initial PCR reaction, remove the unincorporated dNTPs using shrimp alkaline phosphatase (SAP) (Agena Bioscience, California, United States).

The reagents used for the SAP reaction.

The SAP reaction mix contained Amount0.17 µL SAP enzyme, Amount0.30 µL SAP Buffer and Amount1.53 µL of DNase-free distilled water.

Perform the dephosphorylation reaction with a MiniAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) in our laboratory at Faculty of Science, Mahidol University and involved an initial stage at Temperature37 °C for Duration00:40:00 , followed by inactivation at Temperature85 °C for Duration00:05:00 as shown in Table 3.
ABCDE
SAP ReactionVolume reactionTemperatureTimeCycles
Stage 17 µl37 °C40 minutes1
Stage 285 °C5 minutes
Stage 34 °C Hold
Table 3. The SAP reaction conditions and volume.
45m
Temperature
Step 5: The SBE reaction
3m 45s
Subsequent to the SAP reaction, perform the single-base extension (SBE) reaction using a MiniAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) in our laboratory at Faculty of Science, Mahidol University. with a mixture of extension reaction mix synthesized in accordance with the iPLEX® Pro and Gold Reagents User Guide [3, 4].

The extension PCR reaction contained Amount2 µL  PCR reaction mix, Amount0.2 µL iPLEX® Pro Buffer, Amount0.2 µL iPLEX® Pro Termination Mix, Amount0.04 µL iPLEX® Pro Enzyme, Amount0.94 µL Extension Primer and 0.62 of DNase-free distilled water.

The next day, dispense the SBE products onto the SpectroCHIP via a nano-dispenser and then load into the mass spectrometer (MS) for the determination of the molecular mass of the SBE products (Agena Bioscience, California, United States).

Briefly, the SBE reaction begun with an initial step at Temperature95 °C for Duration00:00:30 , continued by 40 cycles including denaturation at Temperature95 °C for Duration00:00:05 , and 5 cycles of an annealing phase at Temperature52 °C for Duration00:00:05 and a denaturation phase at Temperature80 °C for Duration00:00:05 . Conduct the final extension reaction at Temperature72 °C for Duration00:03:00 , followed by a hold at Temperature4 °C DurationOvernight as shown in Table 4.
ABCDE
Extend ReactionVolume reactionTemperatureTimeCycles
Stage 1 9 µl95 °C30 seconds1
Stage 295 °C5 seconds40 cycles
52 °C5 seconds
80 °C5 seconds
52 °C5 seconds
80 °C5 seconds
52 °C5 seconds
80 °C5 seconds
52 °C5 seconds
80 °C5 seconds
52 °C5 seconds
80 °C5 seconds
Stage 372 °C3 minutes1
4 °CHold
Table 4. The SBE reaction conditions and volume.
The reagents used for the iPLEX reaction.

3m 45s
Overnight
Temperature
Finally terminate this reaction by reducing the temperature at Temperature4 °C to end the amplification process.

Temperature
Step 6: The MS
The next day, dispense the SBE products onto the SpectroCHIP via a nanodispenser and load them into the mass spectrometer (MS) to determine their molecular mass.
The SPECTROchip used for the experiment.

Evaluate and interpret the molecular mass and nucleotide-related data for individual SBE products obtained from the MS using MassARRAY® Typer Viewer v4.0 software (Agena Bioscience, California, United States).

Video

Real-time results (video) and the instrument used for the experiment (picture).

Protocol references
1. Htet S, Zannah M, Moe TH, Wongveerakul P, Charoenpanich N, Saengsirisuwan V, et al. The speed-gene study: methods, study design and preliminary results. BMC Res Notes. 2023;16: 345. doi:10.1186/s13104-023-06617-3

2. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22: 4673–4680. doi:10.1093/nar/22.22.4673

3. Millis MP. Medium-throughput SNP genotyping using mass spectrometry: multiplex SNP genotyping using the iPLEX® Gold assay. Methods Mol Biol. 2011;700: 61–76. doi:10.1007/978-1-61737-954-3_5

4. Bradić M, Costa J, Chelo IM. Genotyping with Sequenom. Methods Mol Biol. 2011;772: 193–210. doi:10.1007/978-1-61779-228-1_11