Oct 09, 2015
Seamless editing of the C. elegans genome using CRISPR/Cas9
- Alexandre Paix,
- Yuemeng Wang,
- Harold E. Smith,
- Chih-Yung S. Lee,
- Deepika Calidas,
- Tu Lu,
- Jarrett Smith,
- Helen Schmidt,
- Michael W. Krause,
- and Geraldine Seydoux
- Genetics
External link: http://www.genetics.org/content/198/4/1347.full
Protocol Citation: Alexandre Paix, Yuemeng Wang, Harold E. Smith, Chih-Yung S. Lee, Deepika Calidas, Tu Lu, Jarrett Smith, Helen Schmidt, Michael W. Krause, and Geraldine Seydoux 2015. Seamless editing of the C. elegans genome using CRISPR/Cas9. protocols.io https://dx.doi.org/10.17504/protocols.io.dw67hd
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: September 30, 2015
Last Modified: March 24, 2018
Protocol Integer ID: 1726
Abstract
This protocols is from:
Alexandre Paix, et al. (2014) Scalable and Versatile Genome Editing Using Linear DNAs with Microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 198:1347-1356;doi:10.1534/genetics.114.170423
Guidelines
Reagents
- QIAprep Spin Miniprep Kit: Qiagen, 27104
- MinElute PCR Purification Kit: Qiagen, 28004
- Phusion High‐Fidelity PCR Master Mix with HF Buffer: NEB, M0531L
- GoTaq Green Master Mix: Promega, M7122
- Taq DNA Polymerase: Invitrogen, 10342‐046
- Recovery buffer: 5mm HEPES pH 7.2, 3mM CaCl2, 3mM MgCl2, 66mM NaCl, 2.4mM KCl, 4% Glucose (w/v)
- 10X M9: 420mM Na2HPO4, 220mM KH2PO4, 860mM NaCl, 10mM MgSO4
- Q5 Site‐Directed Mutagenesis Kit: NEB, E0554S
- Lysis buffer:50mM KCl, 10mM Tris pH8.3, 2.5mM MgCl2, 0.45% NP40, 0.45% Tween20. Before worm lysis, add proteinase K to 0.1 ug/ul.
------------------------
Design and cloning of the sgRNAs
Choose sgRNAs that are 1) as close as possible to the modification site and 2) have few off‐target sites. If there are off‐targets sites, they should have 3 or more mismatches, preferentially near the PAM. If possible, choose more than one sgRNAs near each other. Not every sgRNA works, so it’s best to use more than one, until you have one that you know works.
‐The website shows sgRNAs with 20 bases, but we only use the last 19 bases (skip the first base).
‐Order the following primers:
Forward Q5: (N19)gttttagagctagaaatagcaagt
Reverse Q5: caagacatctcgcaatagg
Forward sequencing (for sequencing sgRNA insertion only): tatgaaatgcctacaccctctc
--------------------------
Design of repair ssODNs
The repair oligo should contain flanking bases at both the 5’ and 3’ ends for homologous recombination (sequences identical to genomic DNA). Ideally, flanking sequences should terminate with a C or G and contain good sequence diversity at their extremities (no hairpins). 43nt is the shortest flanking sequence we have tested and 100 is the longest. We do not know the optimal homology arm length for ssODNs. Make sure the homology arms extend as close to the sgRNA cut(s) as possible.
The repair oligo should contain mutations that make it resistant to cutting by Cas9/sgRNA. You can mutate the PAM, insert new bases between the sgRNA sequence and the PAM, or mutate the sgRNA sequence near the PAM (we typically create 4 mismatches).
If the sgRNA targets a coding region, be careful to make only silent changes using codons that are used at similar frequency as
original codon (This site for codon usage in C. elegans may be useful). If possible, avoid sgRNAs that target non‐coding sequences since mutations in these sequences could possibly affect regulatory (splicing, promoters) motifs.
‐If possible, engineer a restriction site (RE) in your oligo to facilitate screening. Make sure that the RE site is either directly in
your edit, or on the distal side of your edit relative to the cut, to ensure that both are incorporated.
‐If you want to insert a premature stop, insert a NheI site between the PAM and sgRNA sequence. Use the TAG codon inside the
NheI site. For maximal gene disruption, we recommend also adding a base to create a frameshift after the TAG codon.
‐Suggestions for protein tags (capital letters represent bases modified to create a RE site):
V5: ggtaagcctatccctaaccctctcctcggtctAgatAGTacT (contains XbaI and ScaI sites)
HA: tacccataTgatgtCccGgattacgct (contains NdeI and NciI sites)
TetraCys: tgctgcccaggatgctgc (contains BstNI site)
3xFLAG: gactacaaagaccatgacggtgattataaagatcatgaTatcgaTtacaaggatgacgatgacaag (contains EcoRV and ClaI sites)
Myc: gaacaaaaactGatAtcagaagaggatctg (contains EcoRV site)
OLLAS: tccggattcgccaacGAGCTCggaccacgtctcatgggaaag (contains SacI site)
‐Order single stranded oligo from Operon (125nt max, 10nmol, salt free) or from IDT (200nt max, 4nM ultramer, salt free). Reconstitute oligo at 1ug/ul according to the amount provided by the manufacturer.
--------------------------
Construction of PCR donor templates for GFP insertion
Optional Nested PCR step: The nested PCR step is included to amplify your PCR further and to eliminate any long primers remaining from the first PCR. This step may be omitted if your PCR is already >500ng/ul and if you used relatively short primers (<60 bases) that are efficiently removed by the minelute PCR purification kit. Perform three nested PCR on this purification using 22‐25nt Fw/Rev primers complementary to the 5’/3’ ends of the template (45s elongation step, 30 cycles, 3*50ul reaction, 60°C annealing). Check the PCR products on agarose gel.
Optional Dpn1 digestion step: This step may not be necessary but is included to eliminate any remaining GFP plasmid template that could form an extrachromosomal array and give you a false GFP+. Add to each 50ul PCR reactions 30ul of H2O, 10ul of Dpn1 (200 units, NEB), 10ul of 10X cutsmart buffer, and incubate at 37°C for 12h and next at 80°C for 20min.
--------------------------
PCR Screening
We recommend testing each gene‐specific PCR assay before starting the injections.
We recommend the following Taq polymerases:
If the PCR product will be processed enzymatically (restriction enzyme): Invitrogen recombinant taq (follow the
manufacturer recommendation for a 50ul reaction, do 30 cycles, 1min or more by kb). Most of restriction enzymes work with
the Invitrogen recombinant Taq buffer.
If the PCR product does not need processing (only looking for a size shift or a positive PCR using GFP internal primer):
Promega Go Taq 2x Master mix.
For PCR products >1.5kb: NEB Phusion 2X Master mix, 30s by kb, 30 cycles. Note that, although regular Taq could
amplify larger fragment, the full length DNA will compete with the edited one, and for amplification of both fragments in the
same mixture, the Phusion Taq is a better choice. Most of the restriction enzymes work with the Phusion buffer.
‐PCR strategies (Figure 1B):
For large insertions, use a primer specific to the insert (“internal primer”): This is best for detecting a large insert (such
as GFP) in a large pool of F1s (8). Use your gene‐specific forward external primer and an internal reverse primer (for GFP use
the GFP reverse primer: cattaacatcaccatctaattc). Do the PCR using GoTaq, 50ul reaction, 30 cycles, 45s‐1min elongation. Note
that the GFP reverse primer works well with annealing temperatures from 55 to 60 °C using a GoTaq.
For small insertions and modifications, design forward and reverse external primers around the edited site (but
OUTSIDE the sequences in the repair template). Ideally, the PCR product should be about 500 bp centered around the edited site. Test your primers on N2 lysis with the appropriate Taq, using a gradient from 55 to 65 °C for regular Taq or 60 to 72 °C for Phusion Taq.
PCR size shift: use a 2.5% gel for insertion/deletion >18bp. For deletion > to 200bp, 1.25% agarose gel is the preferred.
A large number of F1s can be pooled together when looking for a deletion, but we generally pool 8 F1s (makes it easier to
recover edits among F2/3s).
Restriction Enzyme (RE) site insertion: This is the preferred method for a small modification/insertion. 2 F1s can be
pooled. Use 5ul of the PCR product and add RE/buffer/H2O to 10ul. Do the reaction overnight. Most of the REs work with this
approach (we prefer NheI because it works very well at 37 °C, is available in master mix package from NEB, and contains a
putative STOP codon). Run the digestion product on 2.5% gel, short run.
‐Controls:
When screening F1s, we make a reaction master mix (PCR reagents and primers) that is added to each of the F1 lysis
samples. We also prepare several N2 worm lysis samples with master mix only (negative control) and a few with master mix + a
positive control (see below). Be sure to add this positive control PCR after all the other tubes have been closed to avoid
contamination.
Positive control for RE digestion: use a PCR fragment containing the selected restriction sites. This control could be
amplified from a plasmid using the same polymerase than the one used for the screen. Use 5ul of the unpurified PCR.
Positive control for GFP screen: we recommend making a synthetic template containing both your gene‐specific
external forward primer and the GFP internal reverse primer. Using 0.1ul of the repair GFP template, do a PCR using GoTaq, the
GFP internal reverse primer, and a new forward primer containing the sequence of your forward external primer fused to 25‐
28nt complementary to the 5’ end of your repair GFP template. Do the PCR at 60 °C annealing, 50ul reaction, 30 cycles, 45s
elongation. Purify the PCR product and use it as a positive control (100pg).
Another control that can be used when screening for GFP are lysed N2s that receives the PCR master mix as well as the external reverse primer (positive control).
Materials
MATERIALS
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
Phusion High-Fidelity PCR Master Mix with HF Buffer - 500 rxns (50 ul vol)New England BiolabsCatalog #M0531L
GoTaq Green Master MixPromegaCatalog #M7122
Taq DNA PolymeraseThermo ScientificCatalog #10342‐046
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
STEP MATERIALS
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
QIAprep Spin Miniprep KitQiagenCatalog #27104
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
MinElute PCR Purification KitQiagenCatalog #28004
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
QIAprep Spin Miniprep KitQiagenCatalog #27104
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
MinElute PCR Purification KitQiagenCatalog #28004
Protocol materials
MinElute PCR Purification KitQiagenCatalog #28004
MinElute PCR Purification KitQiagenCatalog #28004
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
MinElute PCR Purification KitQiagenCatalog #28004
QIAprep Spin Miniprep KitQiagenCatalog #27104
QIAprep Spin Miniprep KitQiagenCatalog #27104
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
QIAprep Spin Miniprep KitQiagenCatalog #27104
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
Phusion High-Fidelity PCR Master Mix with HF Buffer - 500 rxns (50 ul vol)New England BiolabsCatalog #M0531L
GoTaq Green Master MixPromegaCatalog #M7122
Taq DNA PolymeraseThermo ScientificCatalog #10342‐046
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
QIAprep Spin Miniprep KitQiagenCatalog #27104
QIAprep Spin Miniprep KitQiagenCatalog #27104
MinElute PCR Purification KitQiagenCatalog #28004
MinElute PCR Purification KitQiagenCatalog #28004
Design and cloning of the sgRNAs
Design and cloning of the sgRNAs
Design the sgRNAs and order the primers (see the guidelines).
Clone the sgRNAs in pDD162 using Q5 mutagenesis kit (NEB).
Note
Q5 Site-Directed Mutagenesis Kit - 10 rxnsNew England BiolabsCatalog #E0554S
Mix together the following:
Q5 2X master mix (12.5ul)
Forward primers 10uM (1.25ul)
Reverse primers 10uM (1.25ul)
pDD162 from a 1.5ml bacterial culture miniprep (0.5ul)
H2O (9.5ul)
Prepare a negative control mix without the Forward primer.
Do the PCR as follows:
| 30s at 98°C | |
| 10s/98°C + 20s/60°C + 4.30min/72°C for 25 cycles | |
| 2min at 72°C | |
| 10°C forever |
Digest away pDD162 for 5min at RT with:
| 1ul of Q5 PCR | |
| 5ul of KLD 2X buffer | |
| 1ul of KLD 10X enzyme | |
| 3ul of H2O |
00:05:00
Add 5ul of the digested reaction to 50ul of kit‐provided competent cells
Heat shock at 42°C for 30s
00:00:30
Add 950ul of SOC medium and shake for 1h at 37°C.
01:00:00
Plate 25ul on Carb plate.
Centrifuge the remaining 975ul for 3min at 5K and also plate the pellet.
00:03:00
One half (or more) of the colonies will have the correct insertion. Pick 6 colonies to grow each in 2ml of bacterial culture.
Note
Keep several good clones. It’s best to mix at least two clones for injection to avoid potential clones with mutations in Cas9.
QIAprep Spin Miniprep KitQiagenCatalog #27104
Miniprep (Qiagen kit, include the PB wash, elute in 50ul of H2O) and send to sequencing using the forward sequencing primer in the guidelines.
Note
Keep several good clones. It’s best to mix at least two clones for injection to avoid potential clones with mutations in Cas9.
QIAprep Spin Miniprep KitQiagenCatalog #27104
Design of repair ssODNs
Design of repair ssODNs
Design and order the repair ssODNs as described in the guidelines.
Reconstitute oligo at 1ug/ul according to the amount provided by the manufacturer.
Construction of PCR donor templates for GFP insertion
Construction of PCR donor templates for GFP insertion
Amplify the GFP plasmid pCM1.53 (available at Addgene) with primers containing the desired flanking regions (~30‐60 bp), mutations in the sgRNA site(s) and GFP sequence.
Note
Be sure that you place GFP in frame with your ORF and that you introduce mutations to prevent recutting (as described in section for design of repair ssODNs).
Note
Fw: (flanking region/sgRNA site mutations) agtaaaggagaagaacttttcactggagttg
Rev: (flanking region/sgRNA site mutations) tttgtatagttcgtccatgccatgtgtaatccc
Note
FYI: In one experiment where we inserted GFP right at the cut site, we obtained the highest frequencies using 33/33 bp arms. 15/19 bp arms did not work, and longer arms did not increase edit frequency (Figure 4, Paix et al.).
PCRs are performed using Phusion taq 2X Master Mix (NEB), 45s elongation step, 30 cycles, 50ul reaction. Annealing step is done using a gradient from 60°C to 72°C.
Run PCR reactions on agarose gel to confirm the amplification
Pool positive PCRs (typically three reactions) and purify using a minelute PCR purification kit (Qiagen, elution with 10ul of H2O).
Note
See the guidelines for the "Optional Nested PCR step" and the "Optional Dpn1 digestion step"
MinElute PCR Purification KitQiagenCatalog #28004
Pool the reactions and purify them using one minelute PCR purification column and measure the concentration. The DNA concentration should be >500ng/ul (at this concentration, the amount of PCR oligo remaining in the mixture will be low enough to avoid any toxicity).
Note
Oligos can significantly reduce brood size (Mello et al, 1991) and make it difficult to obtain enough F1 worms for screening.
Preparation of the injection mix
Preparation of the injection mix
We use pRF4 roller plasmid at 120ng/ul, but you can use any marker that you find convenient.
Note
The marker is included to identify successfully injected mothers. Another option to identify broods likely to give edits is to use a Co‐CRISPR method (e.g. Arribere et al., 2014).
Miniprep from 3ml of bacterial culture, as for the Cas9/sgRNA plasmid. Do not let cultures grow for more than 16 hours.
16:00:00
Mix in a small 0.5ml eppendorf tube (Concentrations indicated are final concentrations in injection mix):
| pRF4 (120ng/ul) | |
| Repair template (30ng/ul for a 125nt ssODN, 50ng/ul for a PCR template) | |
| Cas9/sgRNA clones (50ng/ul) | |
| Add H2O to 15ul |
Note
When using multiple oligos, we still keep each around 30ng/ul but BEWARE too much oligo can significantly reduce brood size. We use the same ssODN concentration as recommended in Zhao et al., 2014.
Note
When using multiple sgRNAs, we still keep each individual Cas9/sgRNA plasmid around 50ng/ul. We use the same concentration of Cas9/sgRNA as recommended in Dickinson et al., 2013.
Centrifuge at 13K for 15min on tabletop centrifuge.
00:15:00
Load injection needles with the injection mix.
Note
Be careful not to touch bottom of tube with loading needle – to avoid loading precipitates that will clog your injection needle. Loading the needle under a stereomicroscope can help.
Preparation of worms for injection
Preparation of worms for injection
Bleach a large plate of worms
WashA: wash with M9.
WashB: wash with M9.
Plate embryos (less than 2000) on NA22 large plate. (NOT completely covered with NA22 bacteria)
Incubate multiple plates at different temperatures to ensure to have at least one with young adults (few embryos /one embryo row) on the day of injection.
Pick hermaphrodites with a sharp pick from areas of the plate where there are no bacteria and place on injection pad.
Note
As a baseline: for our lab N2 strain, bleached embryos reached the correct stage for injection after 55 hours at 25°C, or at 15°C for the first night followed by 2 days at 25°C, or at 20°C for 2 days followed by one night at 25°C.
Injections
Injections
Inject 30‐40 worms.
Note
Worm recovery after injection
Worm recovery after injection
AddingM9 #1: add 5ul of M9 (Start adding M9 every 5-10 minutes, about 1h after the worms have been put in recovery buffer
00:05:00
AddingM9 #2: add 5ul of M9
00:05:00
AddingM9 #3: add 5ul of M9
00:05:00
AddingM9 #4: add 10ul of M9
AddingM9 #5: add 10ul of M9
00:05:00
AddingM9 #6: add 15ul of M9
00:05:00
AddingM9 #7: add 15ul of M9
00:05:00
AddingM9 #8: add 15ul of M9
00:05:00
AddingM9 #9: add 20ul of M9
00:05:00
AddingM9 #10: add 20ul of M9
00:05:00
Put a drop of 20ul of M9 on a new OP50 plate, outside the bacteria layer.
With a pick, transfer 5 to 10 injected worms from the recovery buffer to the M9 drop and push them away from the M9 drop towards the food.
Repeat until all the worms are transferred. Even if the worms look inert at this or the next step, they are worth transferring as they may yield edited progeny.
Leave the injected worms on OP50 plates at room temperature for 5h and then transfer each worm (P0) to a new OP50 plate (1 P0 per plate).
05:00:00
Note
We recommend using fresh OP50 plates with thin bacterial lawns – easier to identify roller F1s.
P0 and F1 handling
P0 and F1 handling
Allow the P0s to lay eggs at 20°C for 1 or 2 days.
Transfer the P0s to fresh OP50 plates between the first and second day.
Note
Most of the Roller F1s are found on the first‐day plates. Edits obtained using ssODNs are found on both days. Most edits made using PCR templates are found on the second day plate (see Table S4). Edits are found in both Roller and non‐Roller worms but are only found among broods that contain Rollers.
Let the F1s grow at 20°C. When all the F1s have reached the young adult stage (4 days at 20°C), check for rollers.
Note
Ignore P0s that don't give any rollers at all.
Note
Expect around 20‐50% of P0s to give rollers, but there may be less – in our hands this has varied greatly from experiment to experiment. Recheck plates on subsequent days if you don’t see rollers on initial examination. Rollers grow more slowly than non‐rollers, may not be obvious, and may be very few.
GFP fusions: if you know what you are looking for, it is possible to screen directly for GFP expression in the F1 (or F2) animals.
Note
Keep in mind that, if your sgRNAs are working, 20‐30% of broods will have a very high number of edits (20‐60%) on the second day (“jackpot broods”). To identify jackpot broods, we recommend screening ~20 F1s from the second day plate for all the broods that segregate rollers. Once you have identified GFP+ broods, clone F1s from these to isolate homozygous edits. You can use the PCR screening to confirm the edit and to sequence it.
PCR screening: Transfer the F1 rollers and their non‐roller F1 siblings to new plates (2 to 8 F1s per plate).
Note
We typically try to screen all the F1s (roller and non roller) from P0s with roller progeny, but that may not be necessary depending on the efficiency of your sgRNA.
PCR Screening: Let the F1 lay eggs for 24h at 20°C.
24:00:00
Lyse the F1s for PCR: In each 10 uL tube of lysis buffer, put 2 to 8 F1s.
Note
Use 5ul of lysis for PCR (50ul final volume) (2ul in 25ul final volume PCR could also be used, however some multichannel pipettes are not accurate for volume under 5ul).
Note
Up to 8 F1s may be added to each tube for lysis, if and only if you are screening for a large deletion (50% or less of the full length PCR fragment) or for a positive PCR (using internal primer for GFP insertion).
PCR Screening
PCR Screening
We recommend testing each gene‐specific PCR assay before starting the injections. See the guidelines for PCR Screening details.
Note
We recommend testing each gene‐specific PCR assay before starting the injections.
F2/3 handling
F2/3 handling
Clone the F2/3s from positive F1 plates. It is useful to let the worms crawl on a no‐bacteria plate before picking to avoid accidental transfer of siblings.
If 2 F1s were pooled per plate, clone 16 F2s.
If 8 F1s were pooled per plate, chunk the starved plate if necessary and clone 24 to 32 F2/F3s.
Lyse and PCR F2/3s using the same methods as for the F1s. EXCEPT: When looking for homozygous GFP worms, use primers that flank the GFP fusion.
Use the PCR product for sequencing: Clean 25ul of the PCR reaction using Qiagen Minelute kit, elute with 10ul of H2O. Use 7ul for this elution as a template and use a primer inside the PCR product for sequencing.
Note
If the sequence contains mismatches, use the remaining worm lysis samples to perform a second PCR with Phusion Taq (Phusion Taq has lower error rate than other Taqs).
MinElute PCR Purification KitQiagenCatalog #28004
Once a homozygous F2/3 plate is identified, it is recommended to clone 4 worms again to new plates and to verify their genotype to ensure that the line is truly homozygous.
Freeze the worms. We recommend freezing at least two independent lines (derived from different P0s if possible or different F1s) for each type of edit.