Aug 21, 2020

Public workspace4: User-friendly protocol: Cost-efficient Primer Exchange Reaction (PER) concatemerization (SABER-FISH)

This protocol is a draft, published without a DOI.
  • Jocelyn Y. Kishi1,2,3,
  • Sylvain W. Lapan4,3,
  • Brian J Beliveau1,2,5,3,6,
  • Emma R. West4,3,
  • Allen Zhu1,2,
  • Hiroshi M. Sasaki1,2,
  • Sinem K Saka1,2,
  • Yu Wang1,2,
  • Constance L Cepko4,7,6,
  • Peng Yin1,2,6
  • 1Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA, USA;
  • 2Department of Systems Biology, Harvard Medical School, Boston, MA, USA;
  • 3These authors contributed equally;
  • 4Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, MA, USA;
  • 5Present address: Department of Genome Sciences, University of Washington, Seattle, WA, USA;
  • 6Correspondence: py@hms.harvard.edu (P.Y.), cepko@genetics.med.harvard.edu (C.L.C.), beliveau@uw.edu (B. J. B.);
  • 7Howard Hughes Medical Institute, Chevy Chase, MD, USA
  • Human Cell Atlas Method Development Community
Jocelynkishi
Icon indicating open access to content
QR code linking to this content
External link: http://saber.fish/
Protocol Citation: Jocelyn Y. Kishi, Sylvain W. Lapan, Brian J Beliveau, Emma R. West, Allen Zhu, Hiroshi M. Sasaki, Sinem K Saka, Yu Wang, Constance L Cepko, Peng Yin 2020. 4: User-friendly protocol: Cost-efficient Primer Exchange Reaction (PER) concatemerization (SABER-FISH). protocols.io https://protocols.io/view/4-user-friendly-protocol-cost-efficient-primer-exc-bh9ij94e
Manuscript citation:
Kishi, J.Y., Lapan, S.W., Beliveau, B.J. et al. SABER amplifies FISH: enhanced multiplexed imaging of RNA and DNA in cells and tissues. Nat Methods 16, 533–544 (2019). https://doi.org/10.1038/s41592-019-0404-0
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: July 06, 2020
Last Modified: August 21, 2020
Protocol Integer ID: 38922
Keywords: PER, Primer Exchange Reaction, concatemerization,
Abstract
This protocol explains the cost-efficient Primer Exchange Reaction (PER) concatemerization.



Note
This protocol is part of the SABER-FISH collection.

Attachments
Icon for SABER amplifies FISH_enhanced multiplexed imaging of RNA and DNA in cells and tissues.pdf
SABER amplifies FISH...
3.3MB
Materials
MATERIALS
ReagentMagnesium Sulfate (MgSO4) Solution - 6.0 mlNew England BiolabsCatalog #B1003S
ReagentUltraPure™ DNase/RNase-Free Distilled WaterThermo FisherCatalog #10977023
ReagentE-Gel™ EX Agarose Gels, 1%Thermo FisherCatalog #G402001
Reagent10x PBS
ReagentDeoxynucleotide (dNTP) Solution SetNew England BiolabsCatalog #N0446S
ReagentClean.G hairpin (1µM)
ReagentBst DNA Polymerase (large fragment)MCLABCatalog #BPL-300
ReagentHairpin (5µM)
ReagentProbe oligo pool (10µM)
ReagentSYBR Gold dye
ReagentPB Buffer
ReagentMinElute PCR Purification Kit QiagenCatalog #28004
Clean.G (CCCCGAAAGTGGCCTCGGGCCTTTTGGCCCGAGGCCACTTTCG) is ordered with standard desalting and diluted in H2O.
Note
Note 1: dGTP nucleotides are excluded from the reaction as a string of C’s in the hairpin is used as a stop sequence. The Clean.G oligo incorporates contaminating dGTPs (see Fig. S6 from ref30). The dNTP mix is generated by ordering dNTP’s in separate tubes and mixing A, C, T to a final concentration of Concentration6 millimolar (mM) each. Bst large fragment polymerase NEB (M0275L) can be used instead.
ReagentBst DNA Polymerase Lg Frag - 8,000 unitsNew England BiolabsCatalog #M0275L


Note
Note 2: Hairpin final concentration may be adjusted depending on the desired probe length and properties of the specific hairpin. Extension rates can be quite variable depending on the specific hairpin. As a starting point try Concentration0.5 micromolar (µM) final hairpin concentration for a 60 minute extension reaction. Hairpin concentration, extension time, and other reaction conditions can be adjusted to modify concatemer length (see Fig. 1b and Fig. 1a in the Nature Methods article).


Note
Note 3: We recommend using ddH2O or ideally molecular grade water such as UltaPure DNase/RNase-free distilled water (Invitrogen #10977023), especially if you will be using the concatemers for RNA FISH.
ReagentUltraPure™ DNase/RNase-Free Distilled WaterThermo FisherCatalog #10977023


Note
You can also use dense agarose gel (~1.25%) instead of 1% E-Gel EX agarose gels (Thermo Fisher G402001).

Equipment:
  • Thermocycler
  • nanodrop
Safety warnings
For hazard information and safety warnings, please refer to the SDS (Safety Data Sheet).
Before start
Heat cycler to Temperature37 °C .
PER mix and extension
PER mix and extension
Mix with the following components TemperatureOn ice :
Note
Add the polymerase last.

ComponentVolume ( µL)
10×PBS10
100mM MgSO4* (NEB)10
dNTP mix* (A,C,T only 6mM each, NEB)5
Clean.G (1µM)10
Bst LF polymerase* (McLab)0.5
H2O44.5
*Indicates component concentration can easily be varied to control reaction kinetics and therefore concatemer length, see comments below.

Pipetting
Add mix to strip tube with Amount10 µL 5µM hairpin and mix.
Pipetting
Incubate for Duration00:15:00 at Temperature37 °C , then pause cycler.
Incubation
Remove tube from the cycler, add Amount10 µL 10µM probe oligos and mix.
Pipetting
Incubate at Temperature37 °C for desired extension time (see Note 2).
Incubation
Heat to Temperature80 °C Duration00:20:00 to inactivate the Bst polymerase.
Incubation
Cool to Temperature4 °C .
Check Extension lengths
Check Extension lengths
To check the lengths of extensions, load Amount10 µL of reaction with loading dye on a dense agarose gel (~Concentration1.25 % ). You can also load samples into Concentration1 % E-Gel EX agarose gels (Thermo Fisher G402001).
Note
Note 5: We recommend using primary probes extended to ~500-650 nt and branch probes extended to ~250-450 nt.

Note
Note 6: Because there aren’t G bases in the concatemer sequences, and they are highly single-stranded, intercalating dyes are not as effective as they are at staining other types of sequences (we recommend using the Sybr Gold dye). This means the bands may look faint on the gel but still be efficiently elongated, so don’t be surprised if you need to turn up the contrast quite a bit.



Purification of probes
Purification of probes
While purification of probes is not usually required for cell applications, we have found it helpful for SABER-FISH in tissue.
Purify probes by running Amount90 µL of reaction (for 500 nt probe) over one MinElute PCR purification column (Qiagen #28004).
Add PB buffer to 7×the volume of reaction being purified.
Pipetting

Elute in Amount25 µL ddH2O .
Pipetting
Determine concentration after purification by nanodrop using ssDNA setting.
Analyze
Store probes at Temperature-20 °C .