Dec 14, 2024

Public workspace4-Gene Standard Uniplex PCR Protocol for Antibiotic Resistance Genes and Determinants sul1, erm(B), ctx-m32, and intI1

DOI
dx.doi.org/10.17504/protocols.io.yxmvme6jbg3p/v1
4-Gene Standard Uniplex PCR Protocol for Antibiotic Resistance Genes and Determinants sul1, erm(B), ctx-m32, and intI1
  • Justine C. Condon1,
  • Lisa M. Durso1
  • 1USDA-ARS
Justine C. Condon
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.yxmvme6jbg3p/v1
Protocol Citation: Justine C. Condon, Lisa M. Durso 2024. 4-Gene Standard Uniplex PCR Protocol for Antibiotic Resistance Genes and Determinants sul1, erm(B), ctx-m32, and intI1. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvme6jbg3p/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 25, 2024
Last Modified: December 14, 2024
Protocol Integer ID: 108736
Keywords: Polymerase Chain Reaction (PCR), Gel electrophoresis, 4-Gene Standard Uniplex PCR, antibiotic resistance gene, ARG, antibiotic resistance determinant, sul1, erm(B), ctx-M-, ctx-M-32, intI1, sulfonamide resistance, erythromycin resistance, cefotaxime resistance, extended spectrum beta-lactamase resistance, integrase, antibiotic resistance gene, antibiotic resistance determinant, antibiotic resistance, integrase gene inti1, pcr assay, gene standard uniplex pcr protocol, gel electrophoresi, assayed drug class, general screening tool, assay, determinants sul1
Funders Acknowledgements:
USDA-ARS
Grant ID: NP 212 Soil and Air
Disclaimer
The use of trade, firm, or corporation names in this publication (or page) is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable.
Abstract
A suite of four antibiotic resistance determinants were selected as a general screening tool for agricultural and environmental samples. It included antibiotic resistance genes from three commonly assayed drug classes (sul1, erm(b) and ctx-m) and one determinant often associated with human-impacted samples (the integrase gene intI1). This protocol describes the correct procedures on how to set-up and run the PCR assay and gel electrophoresis.
Image Attribution
Stock Photo
Guidelines
Scope

  • Polymerase Chain Reaction (PCR) is a technique that enables researchers to rapidly and efficiently amplify (copy) a specific region of DNA (Deoxyribonucleic Acid) or RNA (Ribonucleic Acid) into millions of copies.
  • A simple PCR reaction consists of target DNA, a set of synthetic oligonucleotide primers that flank the target DNA sequence, a thermostable DNA polymerase (usually Taq polymerase), and nucleotides.
  • Thermal cycling exposes these contents to repeated cycles of heating and cooling that promotes DNA replication. There are three steps involved in the process:

  1. denaturation
  2. annealing
  3. elongation

This assay is for the detection of sul1, erm(B), ctx-m-32, and intI1. In June 2020, the forward and reverse primers for intI1 were flip-flopped from the Hardwick orientation and are now based according to Dr. Lana Castleberry’s recommendations and her use of the primers in the 4G multiplex assay. See 'References' section for references.

Responsibility

This SOP applies to all staff members and students. These individuals must be knowledgeable about the requirements set forth within this document. The lab manager or designee shall ensure that all staff and students know the proper techniques.

Disclaimer

The use of trade, firm, or corporation names in this publication (or page) is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable.


Materials
Reagents and Materials

  • ReagentJumpStart™ REDTaq® ReadyMix™ Reaction MixMerck MilliporeSigma (Sigma-Aldrich)Catalog #P0982
  • Forward and Reverse Primers – See Table 2 (Step 4.3)
  • PCR Water (HyClone SH30538.01 Sigma, St. Louis, MO)
  • Positive Controls – gBlocks– See Appendix (Steps 31-34)
  • ReagentAgaroseMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9539
  • ReagentSYBR SAFE DNA stainInvitrogen - Thermo FisherCatalog #S33102
  • ReagentDirectLoad™ PCR 100 bp Low LadderMerck MilliporeSigma (Sigma-Aldrich)Catalog #D3687
  • 0.2 mL x 8 PCR reaction strips (T320-2N, Simport, Quebec, Canada)
  • 2 mL sterile centrifuge tube (02.681.299 Fisher Scientific, Pittsburg, PA)
  • Aerosol barrier no retention pipette tips (USA Scientific, Orlando, FL)
  • 1X SB buffer (20X Sodium Borate (SB) Buffer - SB20-4, FasterBetter Media, Hunt Valley, MD)

Equipment

  • PCR Prep Cabinet (3620804 Labconco, Kansas City, MO)
  • Pipettors for various volumes from 1-1000µl (Gilson, Middleton, WI)
  • Thermal cycler (T100, BioRad, Hercules, CA)
  • Mini Centrifuge (C1301P, Labnet International, Big Flats, NY)
  • 1 Liter or 500ml sterile Pyrex glass bottle
  • Gel casting tray, gel combs, and gel boat
  • Electrophoresis machine (PowerEase 300W, Life Technologies, Carlsbad, CA)
  • Gel imaging apparatus (Gel Doc XR+, BioRad, Hercules, CA)
  • Lighter


Troubleshooting
Safety warnings
Wear proper personal protective equipment (PPE) when working through PCR: nitrile gloves and lab coat.

When working with the hot agarose, wear thermal hot-pad gloves.
Procedure - PCR
15m
If frozen, thaw all reagents and samples and keep on an ice block or ice for stability. If kept in the refrigerator, keep there until ready for use, and keep on an ice block or ice for stability when in use.
Temperature
Label tubes for the samples and controls.
Prepare the PCR prep area for setting up a PCR reaction to eliminate contamination – UV 0.2mL 8-strip PCR tubes, PCR water, and microcentrifuge tube for Duration00:15:00 .

15m
Centrifigation
Combine the Master Mix components for the number of reactions (allow for 10% extra Master Mix) using the recipe from Table 1 (Go to ) with the correct primer sets (Table 2 (Go to )) for 20µL reactions.

Before adding to the Master Mix - mix the primers by aspirating and expelling with the pipette tip.

Note
*Beware, overmixing can degrade the DNA.

Pipetting
Mix
ABCD
Component Description Volume/RXN (µl) Final Concentration
Primer 1 Forward Primer (100µM) 0.4 2µM
Primer 2 Reverse Primer (100µM) 0.4 2µM
TAQ JumpStart RedTaq ReadyMix Reaction Mix (Cat.#P0982) 10 1X
PCR Water PCR Water (HyClone SH30538.01) 4.2 N/A
Sample Template (& positive control) 5.0
Table 1. PCR Master Mix recipe. 20µL total reaction volume.
.
ABCDEFG
Gene Type Sequence 5' to 3' TM (°C) TC Conditions Amplicon Size (bp) Sequence Reference
sul1 Forward GACGAGATTGTGCGGTTCTT 64 1 cycle at 94°C for 2 min; 35 cycles at 94°C for 30s, 64°C for 30 s, 72°C for 2 min; 1 cycle at 72°C for 5 min. 185 Szczepanowski et al., 2009
Reverse GAGACCAATAGCGGAAGCC
erm(B) Forward GATACCGTTTACGAAATTGG 58 1 cycle at 94°C for 2 min, 35 cycles at 94°C for 30 s, 58°C for 30 s, 72°C for 2 min; 1 cycle at 72°C for 5 min. 364 Chen et al, 2007
Reverse GAATCGAGACTTGAGTGTGC
ctx-m-32 Forward CGTCACGCTGTTGTTAGGAA 63 1 cycle at 94°C for 2 min; 35 cycles at 94°C for 30 s, 63°C for 30 s, 72°C for 2 min; 1 cycle at 72°C for 5 min. 156 Szczepanowski et al., 2009
Reverse CGCTCATCAGCACGATAAAG
intI1 Forward ACATGCGTGTAAATCATCGTCG 60 1 cycle at 94°C for 2 min; 35 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 2 min; 1 cycle at 72°C for 5 min 473 Hardwick et al., 2008
ReverseCTGGATTTCGATCACGGCACG Castleberry 2018
Table 2. Primer sequences, melting temperature, and thermal cycling conditions.

PCR
Vortex the completed Master Mix for at least Duration00:00:20 .

20s
Mix

Note
*Check the pipette’s volume as you go along, making sure it is exactly at the correct volume*

Carefully pipette Amount5 µL of PCR Water to the non-template control (NTC) tube.

Add Amount15 µL of Master Mix to each labeled, 0.2mL PCR tubes.

Pipetting
Mix
Next, gently vortex to mix, then pipette Amount5 µL of sample (Amount5 µL of working stock; or Amount1 µL straight DNA + Amount4 µL PCR water) into its same labeled tube.

Note
Use a new pipette tip for each sample.

Pipetting
Mix
To make a working stock dilution, see SOP: IDT Primer and gBlock Hydration and Aliquots.



Add Amount5 µL of positive control (mix first by aspirating and expelling with the pipette tip) to its same labeled tube.

Pipetting
Mix
Centrifuge the strip tubes so that the entire volume is at the bottom.

Note
Make sure the centrifuge is balanced with both sides containing tubes.

Centrifigation
Load the tubes into the Thermocycler, keeping them in order.
Find the programmed gene conditions listed under ‘4G --’ and double check that they match the conditions listed in Table 2 [Go to ].

Run PCR

  • When cycle is complete:
PCR
Procedure - Gel Electrophoresis, Steps Go to -Go to OR

Place the tubes in a labeled rack at Temperature-20 °C until ready to run a gel.

Turn off the Thermocycler.
Procedure – Gel Electrophoresis
3h 11m 30s
Using a spoon, measure out Amount2.6 g of powdered agarose into a weigh boat.

Measure Amount260 mL of 1X SB buffer into a graduated cylinder.

Add the powdered agarose and 1X SB into 500mL bottle and swirl to mix.
Mix
Microwave the SB and agarose mixture for Duration00:01:00 with bottle lid LOOSE.

1m
Remove bottle from microwave (using hot pad gloves), tighten the lid and gently swirl.

Safety information
For Steps 19 - 27 - Use thermal hot pad gloves to protect from burns.

Temperature
LOOSEN the lid and put in microwave for another minute.
Check mixture visually, if flecks are present repeat Go to , loosen lid and microwave again for Duration00:00:30 .

30s
Add Amount26 µL of SYBR safe to molten gel.

Pipetting
Temperature
Swirl gently with a loose lid to distribute SYBR.
Place bottle in Temperature55 °C water bath for Duration00:10:00 to temper.

10m
Temperature
While the mixture is tempering, set up gel cast by putting two plastic stoppers into the ends of the cast, with the orange rubber side of the stopper facing out.
Put two (or three) 36-well combs into the first and fourth notches of the gel cast (gel cast is right side up if first notch is close to the top of the cast)
After the gel has tempered, slowly pour it (using hot pad gloves) into the gel cast.
Temperature
If there are any noticeable bubbles, take a lighter and hold it over the bubble, which should make it pop.
Cover gel loosely with foil and allow it to set (up to Duration01:00:00 ) before use.
Note
**SB gels will be flimsier, so be careful when removing the combs or transporting the gel**


1h
Electrophoresis Conditions
Amount10 µL of PCR amplicon will go into each well flanked by Amount5 µL of ladder.

Run at 120 volts (V) for Duration02:00:00 in 1x SB buffer.
Note
Make sure SB gel goes into a gel boat with SB buffer.


2h
Critical
Remove processed gel and analyze using a gel imaging system.
Analyze
Appendix – Positive Control (gBlock) Sequences

*Note: 'Reverse' denotes the 'Reverse Complement'
gBlock 3 – sul1 (344 bp) - for 4G assay and primer set P2-sul1
Escherichia coli R46 sul1 gene for sulfonamide-resistant dihydropteroate synthase Sul1, complete CDS NCBI Reference Sequence: NG_048081.1



gBlock 17 – ermB (424 bp) – for 4G assay and primer set P3-ermB


gBlock 18 – ctxm-32 (249 bp) – for 4G assay and primer set P4–ctxm32



gBlock 19 – intI1 (535 bp) - for 4G assay and primer set P5-intI1



Protocol references
Castleberry, Lana. 2018. 4Gene Multiplex PCR assay troubleshooting notes.

Chen et al, 2007. Chen, J., Y. Zhongtang, F. C. Michel, Jr., T. Wittum, and M. Morrison. 2007. Development and Application of Real-Time PCR Assays for Quantification of erm Genes Conferring Resistance in Macrolides-Lincosamides-Streptogramin B in Livestock Manure and Manure Management Systems. Appl and Environ Micro. 73(14):4407-4416.

Hardwick et al., 2008 Hardwick, S.A., H.W. Stokes, S. Findlay, M. Taylor, and M.R. Gillings. 2008. Quantification of class 1 integron abundance in natural environments using real-time quantitative PCR. FEMS Microbiol. Lett. 278:207-212.

Szczepanowski et al., 2009. Szczepanowski, R., B. Linke, I. Krahn, K-H. Gartemann, T. Guetzkow, W. Eicher, A. Pühler, A. Schlueter. 2009. Detection of 140clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology. 155(7):2306-2319.

Thames et al., 2012 Thames, C.H., Pruden, A., James, R.E., Ray, P.P., Knowlton, K.F. Excretion of antibiotic resistance genes by dairy calves fed milk replacers with varying doses of antibiotics. Frontiers in Microbiology. (2012) 3:139 1-12.