Jun 01, 2024

18S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method

18S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method
  • 1Hakai Institute
  • Hakai Genomics
Icon indicating open access to content
QR code linking to this content
External link: https://hakai.org
Protocol Citationrute.carvalho Carvalho, Colleen Kellogg, Matt Lemay 2024. 18S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzjjjxlx1/v1
Manuscript citation:
Andreas Novotny, Caterina Rodrigues, Loïc Jacquemot, Rute B G Clemente-Carvalho, Rebecca S Piercey, Evan Morien, Moira Galbraith, Colleen T E Kellogg, Matthew A Lemay, Brian P V Hunt, DNA metabarcoding captures temporal and vertical dynamics of mesozooplankton communities, ICES Journal of Marine Science, Volume 82, Issue 2, February 2025, fsaf007, https://doi.org/10.1093/icesjms/fsaf007
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 30, 2024
Last Modified: June 01, 2024
Protocol  Integer ID: 100974
Keywords: 18S rRNA, eDNA, eukaryote diversity, Illumina Sequencing, plankton communities in the northern salish sea, taxonomic annotations of eukaryote nuclear dna, rrna gene, plankton community, eukaryote nuclear dna, taxonomic annotation, end illumina miseq sequencing, part of the hakai institute ocean observing program, hakai institute ocean observing program, northern salish sea, pcr method this protocol, biomolecular sample, pcr method, dna, pcr, edna metabarcoding, gene, sequencing
Abstract
This protocol is used for eDNA metabarcoding of the 18S SSU rRNA Gene (Balzano et al 2015) using Pair-End Illumina Miseq. Sequencing. As part of the Hakai Institute Ocean Observing Program, biomolecular samples have been collected weekly, from 0 m to near bottom (260 m), to genetically characterize plankton communities in the Northern Salish Sea since 2015. This protocol is developed to provide taxonomic annotations of Eukaryote Nuclear DNA.
Guidelines
MIOP: Minimum Information about an Omics Protocol
MIOP TermValue
analysesAmplicon Sequencing, 18S
audiencescientists
broad-scale environmental contextmarine biome ENVO_00000447
creatorRute Carvalho
environmental mediumsea water [ENVO:00002149]
geographic locationNorth Pacific Ocean [GAZ:00002410]
hasVersion1
issued2024
languageen
licenseCC BY 4.0
local environmental contextcoastal sea water [ENVO: 00002150]
materials requiredSterile workbench, Thermo Cykler, MiSeq, Gel Electrophoresis syste, Qbit, Bioanalyzer
maturity levelMature
methodology categoryOmics Analysis
personnel required1
projectBiomolecular surveys of marine biodiversity in the Northern Salish Sea, BC
publisherHakai Institute, Ocean Observing Program
purposeDNA metabarcoding
skills requiredsterile technique | pipetting skills
targetEukaryote Nuclear DNA
time required3-5 days
AUTHORS
PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.AFFILIATIONORCID (visit https://orcid.org/ to register)DATE
Rute CarvalhoHakai Institutehttps://orcid.org/0000-0001-6922-94182024
Colleen KelloggHakai Institutehttps://orcid.org/0000-0001-6922-94182024
Matt LemayHakai Institutehttps://orcid.org/0000-0001-7051-00202024
RELATED PROTOCOLS
PROTOCOL NAME AND LINKISSUER / AUTHORRELEASE DATE This is the date corresponding to the version listed to the left
Content CellContent Cellyyyy-mm-dd
Content CellContent Cellyyyy-mm-dd
This is a list of other protocols which should be known to users of this protocol. Please include the link to each related protocol.
ACRONYMS AND ABBREVIATIONS

ACRONYM / ABBREVIATIONDEFINITION
Content CellContent Cell

GLOSSARY

SPECIALISED TERMDEFINITION
Content CellContent Cell
Content CellContent Cell

BACKGROUND This protocol is used for eDNA metabarcoding of the 18S SSU rRNA Gene (Balzano et al 2015) using Pair-End Illumina MiSeq Sequencing.
Citation
Sergio Balzano, Elsa Abs, Sophie C. Leterme (2015). Protist diversity along a salinity gradient in a coastal lagoon. Aquatic Microbial Ecology.
LINK

Method description and rationale Assuming extracted DNA as starting material, this protocol includes the following steps:

  1. First PCR: Triplicate locus-specific amplification of the 320 bp ling "Leray fragment" of the COI gene.
  2. First PCR product purification (using magnetic beads)
  3. Second PCR: Sample indexing using Nextera V2 indexing primers
  4. Second PCR product purification (using magnetic beads)
  5. Quantification and Pooling
  6. Quality control
  7. Pair End Sequencing on Illumina MiSeq V3 2*300 bp

Due to the risk of cross contamination, it is pivotal to separate work with amplified PCR products from pre-PCR steps. We preform pre-PCR steps (including DNA extractions) in separate clean rooms on surfaces steralized with hydrogen peroxide (PreEmpt) and UV.
Spatial coverage and environment(s) of relevance As part of the Hakai Institute Ocean Observing Program, biomolecular samples have been collected weekly, from 0 to near bottom (260 m), to genetically characterize plankton communities in the Northern Salish Sea since 2015, developing a climatology from which we can begin uncover the physical, chemical and biological drivers of community and functional change in the dynamic coastal waters of coastal British Columbia. This protocol is developed to give a species-level resolution of marine eukaryotes. Personnel Required 1 Technician
Safety Identify hazards associated with the procedure and specify protective equipment and safety training required to safely execute the procedure!
Training requirements Serile work technique, pipetting skills, PCR, gel electrophoresis.
Time needed to execute the procedure This protocol may take several days to complete depending on sample size.
Materials
Equipment
  • pre-PCR and post-PCR separated workspaces
  • Thermocycler (1 or 3)
  • Gel electrophoresis equipment
  • Qubit or plate reader
  • Magnetic plate
  • BioAnalyzer
  • Real-Time PCR
  • Illumina MiSeq
Protocol materials
100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
Gel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
Qubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853
Quant-iT dsDNA Pico Green assay kit (Invitrogen)Life TechnologiesCatalog #P7589
Qubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854
Bioanalyzer chips and reagents (DNA 1000)Agilent TechnologiesCatalog #5067-1504
NEBNext Library Quant Kit for Illumina - 100 rxnsNew England BiolabsCatalog #E7630S
PhiX Control v3Illumina, Inc.Catalog #FC-110-3001
MiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001
Molecular Biology Grade WaterCorningCatalog #46-000-CV
Taq FroggaMixFroggabioCatalog #FBTAQM96
BSA-Molecular Biology Grade - 12 mgNew England BiolabsCatalog #B9000S
Froggarose LEFroggabioCatalog #A87-500G
Before start
Read Minimum Information about an Omics Protocol (MIOP) and other recommendations under the "Guidelines" tab.
Preparations
Ensure that the laboratory is appropriately configured and that staff has appropriate training. See "Guidelines" for more information. Pay attention to the separation of pre and post-PCR spaces and equipment.
Ensure that all reagents are aliquoted in appropriate amounts, and stored according to manufacturers' recommendations. Never pipet directly from reagent stocks.
Prepare the SPRI beads' working solution, and test their efficiency following this protocol.
Protocol
Serapure Preparation and Testing
CREATED BY
Andreas Novotny

Prepare primer working stocks (10μM) for both the first and second PCR steps. Here we use Nextera V2 Kit Sets A, B, C, and D. We advise preparing the indexing primers on 96-well plates according to this configuration:
Download Indexes_plate.xlsxIndexes_plate.xlsx38.5KB
We advise adding aliquots of the extracted DNA to a 96-Well PCR plate to facilitate the setup of the PCR reaction. This metadata template will help keep track of the samples, and if indexes are configured as described above, also the identity of sample indexes.
Triplicate PCR Amplification (1st PCR)
Preparations

Note
  1. Prepare PCR reactions in a clean working space (such as a biosafety cabinet) dedicated to pre-PCR tasks only.
  2. Do not need to Qubit DNA samples before starting, only do it if the reaction does not work. 
  3. Use samples diluted 1:10 (1 μl DNA in 9 μl Nuclease-Free Water) 
  4. Test at least 8 samples before doing a batch/plate. 
  5. Include a negative control, an extraction blank (if you have it), and a positive control. 
  6. After testing, perform the PCR for all of the samples in triplicates.

Reagents:
Molecular Biology Grade WaterCorningCatalog #46-000-CV (Or equal)
Taq FroggaMixFroggabioCatalog #FBTAQM96
BSA-Molecular Biology Grade - 12 mgNew England BiolabsCatalog #B9000S
Froggarose LEFroggabioCatalog #A87-500G
100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
Gel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
  • Custom-designed primers (Balzano et al 2015) including:
PCR Primer NameDirectionSequence (5’ -> 3’)
Balzano_565F_overhangforwardTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCAGCASCYGCGGTAATTCC
Balzano_981R_overhangreverseGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTTTCGTTCTTGATYRR

UV for 30 minutes the following:  
  • 96-well PCR plates (or 8-strip tubes)  
  • Sharpie 
  • Pipette tips 
  • Multichannel pipettes  
  • Pipettes  
  • Sterile Nuclease-Free Water

Thaw Taq, BSA, Primers, and nuclease-free water. Keep them in a cooling microcentrifuge tube rack.
PCR reactions are carried out in triplicate 25μl reactions:
ReagentVolume (μl)
Sterile Nuclease-Free water7.3
Forward primer (10μM)0.6
Reverse Primer (10μM)0.6
BSA (10mg/ml)2
2XTaq12.5
DNA (1-10 ng)2
TOTAL25

30m
Seal the 96-well plates and transfer them to thermocyclers.

Note
Amplified PCR products should never come in contact with equipment used for non-amplified DNA.
From this point, no samples will reenter the pre-PCR working space.
PCR stepTemperatureDurationRepetition
denaturation98°C1 minutes
denaturation98°C30 seconds
annealing53°C30 seconds
extension72°C45 seconds
GO TO step 210 times
denaturation98°C10 seconds
annealing50°C30 seconds
extension72°C10 seconds
GO TO step 619 times
final extension72°C2 minutes
HOLD12°CHOLD

2h
Run a subset of the PCR product (5μl) on a 1.5% agarose gel to check the size of the amplicons and the success of the amplification.

Expected result
If any additional bands appear that are not the desired product's size, increase the PCR's annealing temperature or perform additional purification steps.

1h
Purification of first PCR product using SPRI beads
Preparations
Note
Prepare the purification in the post-PCR working space.

Size selection can be achieved using different ratios of magnetic beads to sample. A rate of bead to a sample of 0.8-1.5 will efficiently purify the amplicons away from primer dimers and allow the selection of fragments larger than 200 bp.

Materials  
  • Serapure SPRI beads. If not already prepared:
  • Magnetic 96-well plate stand 
  • Anhydrous Ethanol to make a fresh 80% ethanol solution 
  • Molecular grade water  

UV for 30 minutes the following:  
  • 96-well PCR plates (or 8-strip tubes)  
  • Sharpie 
  • Pipette tips 
  • Multichannel pipettes  
  • Pipettes  
  • Sterile Nuclease-Free Water

Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
Vortex the beads before use.
  • Add 16 μl beads to 20 μl of PCR product to obtain a ratio of 0.8.
  • Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes).
  • Spin tubes down to remove drops from the walls.
15m
Incubate at room temperature without shaking for 5 min.
Then, place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).
8m
Remove the supernatant with a multichannel pipette, ensuring to not disturb the beads.
5m
With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol and incubate for 30s. Carefully remove the supernatant without disturbing the beads.
10m
Repeat the washing step
10m
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*).

Note
*This depends on the type of the magnetic rack – the O-ring magnet dries faster than the side magnet. Keep an eye on the beads and do not over-dry. Otherwise, you will not get an efficient DNA recovery.

5m
 Remove the plate from the magnetic stand and add 40 μl of nuclease-free water for elution. Gently pipet up and down ten times to resuspend the beads.  Incubate the plate at room temperature for 5 min.
5m
Place the plate back on the magnetic rack for at least 5 min or until the supernatant is cleared. 
5m
Carefully transfer 30 μl of the clear supernatant to a new plate. Seal the plate.
Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date,  Initials.
Samples can be stored at -20°C for up to 7 days.

(IF this is the cleanup of the second PCR product )
Indexing PCR amplification (2nd PCR)
Preparations

Reagents:
Taq FroggaMixFroggabioCatalog #FBTAQM96
Molecular Biology Grade WaterCorningCatalog #46-000-CV
Froggarose LEFroggabioCatalog #A87-500G
100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
Gel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
  • i5 and i7 index plates (10 μM) – If not already prepared:
PCR Primer NameDirectionSequence (5’ -> 3’)
Nextera V2 Index1forwardCAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Nextera V2 Index 2reverseAATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
UV for 30 minutes the following:  
- 96-well PCR plates (or 8-strip tubes)  
- Sharpie 
- Pipette tips 
- Multichannel pipettes  
- Pipettes  
- Sterile Nuclease-Free Water

Thaw Taq, i5 and i7 indexes, and nuclease-free water. Keep them in the  IsoFreeze microcentrifuge tube rack.

Dilute the cleaned-up PCR (1:10) with sterile nuclease-free water.
Prepare PCR reaction in 25μl reactions:
ReagentVolume (μl)
Sterile Nuclease-Free water5
Forward primer (10μM)2.5
Reverse Primer (10μM)2.5
2XTaq12.5
DNA (1-10 ng)2.5
TOTAL25

Seal the 96-well plates and transfer them to thermocyclers.
PCR stepTemperatureDurationRepetition
denaturation95°C3 minutes
denaturation95°C30 seconds
annealing55°C30 seconds
extension72°C30 seconds
GO TO step 27X
final extension72°C5 minutes
HOLD12°CHOLD
Run a subset of the PCR product (5μl) on a 1.5% agarose gel to check the size of the amplicons and the success of the amplification.

Note
If any additional bands appear that are not the size of the desired product, additional purification steps need to be carried out.

Purification of indexed libraries (Second bead cleanup)
Repeat the Ampure XP bead cleanup for all the indexed libraries.
Purification

Quantification and pooling, and quality control
Use a fluorometric quantification method that uses dsDNA dyes to measure the concentration of your libraries (Qubit or plate reader). If using Qubit, give preference to the broad range kit if you visualize a strong band in the gel:Qubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853 OR
Quant-iT dsDNA Pico Green assay kit (Invitrogen)Life TechnologiesCatalog #P7589

Expected result
Samples will have approximately similar concentrations (usually). Re-check samples that showed very high or low concentrations on Qubit/plate reader quantification. 

Calculate sample volume to have a final amount of 10-40 ng. This amount may vary depending on the overall quantification. For example, if on average the concentration of your samples is about 3 ng/μl and you have 20 μl of product,  you can calculate the volume to make up to 60 ng per sample.

Note
Check the final volume that you will get after pooling – sometimes you will end up with 2 mL or more. Then use the proper Eppendorf tube for pooling (1.5, 2.0, or 5 mL).

Measure the final library pool concentration on Qubit using
Qubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854

Label tube: [Gene_name], [Project_Name], Pooled Amplicons. Date, Initials, pool concentration.
Sequencing parameters
Library fragment size (BP) is determined using Bioanalyzer chips and reagents (DNA 1000)Agilent TechnologiesCatalog #5067-1504
Molarity of thefinal pool is assessed using NEBNext Library Quant Kit for Illumina - 100 rxnsNew England BiolabsCatalog #E7630S
COI libraries are sequenced an a MiSeq instrument using:
MiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001 with pair-end setup (2*300 bp), spiked with 10% PhiX Control v3Illumina, Inc.Catalog #FC-110-3001 .

Citations
Sergio Balzano, Elsa Abs, Sophie C. Leterme. Protist diversity along a salinity gradient in a coastal lagoon
https://doi.org/10.3354/ame01740