Oct 22, 2025

Public workspace18 Loci Variant Perturb-Seq Protocol (ABE)

  • Quang Vinh Phan1,
  • Richard Sherwood1
  • 1Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA
Icon indicating open access to content
QR code linking to this content
Protocol CitationQuang Vinh Phan, Richard Sherwood 2025. 18 Loci Variant Perturb-Seq Protocol (ABE). protocols.io https://dx.doi.org/10.17504/protocols.io.3byl461mrgo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 21, 2025
Last Modified: October 22, 2025
Protocol Integer ID: 230389
Keywords: using crispr base editing screening, crispr base editing screening, robust phenotypes in crispr screen, cholesterol trait, variants with strong gwas evidence, genes within these loci, identified numerous single nucleotide polymorphism, known monogenic disease gene, human genetic evidence, monogenic disease gene, crispr, numerous single nucleotide polymorphism, gene, used human genetic evidence, using cholesterol, strong gwas evidence, genome, ancestry gwa, related phenotypic assay, robust phenotype, crispr screen, phenotypic assay, variants with strong evidence, loci variant installation protocol, trait, gwa, liver eqtl, same trait, snp, various trait, human hepatocyte cell line, ldl uptake screen, impact on the transcriptome, transcriptome, loci variant perturb, wide association study, functional consequences of these variant, burden for these same trait
Funders Acknowledgements:
Pinello
Grant ID: HG012010
Abstract
Genome-wide association studies (GWAS) have identified numerous single nucleotide polymorphisms (SNPs) associated with various traits and diseases, yet understanding the functional consequences of these variants remains challenging. We have chosen a set of 18 loci associated with cholesterol traits (LDL-C and HDL-C) in a recent trans-ancestry GWAS (Graham et al 2021, Nature, GLGC consortium). Genes within these loci have coding burden for these same traits and/or are known monogenic disease genes, and importantly, targeting these genes gives robust phenotypes in CRISPR screens using cholesterol-related phenotypic assays. We have used human genetic evidence to select ~2,500 variants within these 18 loci to evaluate, including variants with strong GWAS evidence and variants with strong evidence as liver eQTLs through fine-mapping and/or linkage to sentinel variants.

This protocol describes pooled Perturb-Seq with selected variants of interest to characterize each variant on their impact on the transcriptome.
Troubleshooting
Guide library Cloning
Library structure
GGCTTTATATATCTTGTGGAAAGGACGAAACACCG(19-20-bp protospacer—remove initial G for any 20-bp protospacer with one natively) GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTT
Reconstitution of ssDNA oligo pool
Spin down lyophilized ssDNA oligo pool
Prepare 2 ng/µL stock by resuspending in TE buffer with low EDTA (10mM Tris-Cl pH 8.0, 0.1 mM EDTA)
Store at -20 °C.
Restriction digest of CRISPRv2FE-ABE8e-SpRY-BsrGI library backbone
Cut 10 µg CRISPRv2FE-ABE8e-SpRY-BsrGI with BsmBI-V2 and BsrGI-HF
Restriction digest reaction mix overview:
AB
H2Oad 100 µl
NEB 3.110 µL
CRISPRv2FE-ABE8e-SpRY-BsrGI10 µg
BsmBI-v210 units
BsrGI-HF10 units


Incubate at 55 °C for 3-4 hours with BsmBI-V2, then add BsrGI-HF and incubate at 37°C for another 3-4 hours.
Run digest on 1% agarose gel with SYBR and cut out band at 13.7 kbp.
Amplification of library
Amplification of library done with the following primers:

010415_sgRNA_60bp_fw     TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG

010415_sgRNA_60bp_rv     GTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC
Determination of optimal PCR cycles for library amplification
Run a qPCR with 0.5 µl of 1122_18LDLlocus_ABE_gRNAlib library in 15 µl qPCR to determine optimal cycles using the primers above.

qPCR mix
AB
Oligo pool 0.5 uL
2x Q5 mix 7.5 uL
F primer @20uM 0.375 uL
R primer @20uM 0.375 uL
dd H205.5 uL
20x EVA Green0.75

qPCR program
ABCDEF
98 °C 98 °C 65 °C 72 °C 72 °C 4 °C
30 sec10 sec30 sec60 sec5 min remaining
Repeat steps B-D for 20x

Identify the cycle number where the qPCR stops log-linear increase (this is typically 4-5 cycles after the CT), determine how much more input in PCR as in qPCR and subtract the log2 ratio (e.g. if using 0.5 uL, keep as is, if using 1 uL, subtract 1 cycle, if using 2 uL, subtract 2 cycles), to identify PCR1 cycle number.
Library amplification

Once optimal cycle number is determined, run a 100 µl PCR with the following conditions:
AB
Oligo pool 0.5 uL
2x Q5 mix 50 uL
F primer @20uM 2.5 uL
R primer @20uM 2.5 uL
dd H2044.5 uL

ABCDEF
98 °C 98 °C 65 °C 72 °C 72 °C 4 °C
30 sec10 sec30 sec60 sec5 min remaining
Repeats steps B-D with the determined optimal cycle numbers.
Load PCR onto a 2% agarose gel with SYBR and gel purify band at 299 bp.

Gibson assembly
AB
2xNEB HiFi assembly mix 50 ul
Digested CRISPRv2FE-ABE8e-SpRY-BsrGI2100 ng (0.25 pmol)
Purified library PCR140 ng (0.75 pmol)
Waterad 100 ul
Incubate at 50°C for 1 hour.
Cleanup/concentration
Add 1 ul GlycoBlue, 2 ul 50mM NaCl, 100 ul Isopropanol to the Gibson reaction system
Vortex, incubate at room temperature for 15 min
SPIN > 15.000 g for 15 min
Carefully remove liquid without disturbing pellet
Wash with 300 ul 80% EtOH and SPIN >15.000 g for 5 min
Remove most liquid with P1000 and spin at >15,000 g for 1 min
Carefully remove all liquid with p200, making sure tube has no liquid left, and air-dry pellet 3-5 min by keeping cap open and leaving at room temp
Add 8.25 ul EB, warming at 55°C for 10min to fully resuspend
Determination of Coverage and Diversity of Cloned Library
Transformation of a small amount of the assembly mix for the determination of diversity and coverage of the cloned library.
Add 0.25 µl of the purified assembled mix into a 1.5 ml tube and gently mix with 25 µl of NEB Stable cells. Incubate for 30 minutes on ice.
Heat shock at 42°C for 30 seconds and put back on ice for 1 minute.
Add 975 µl of NEB 10-beta/Stable Outgrowth Medium and incubate at 30°C for 1 hour while shaking.
Plate 1/10, 1/100, and 1/1,000 of transformation mix onto LB agar plates (supplied with 100 µg/ml ampicillin). Incubate at 30°C overnight.
Calculation of the Coverage
Choose the dilution plate with colony numbers in the range between 20-200 and count the colonies. Calculate the coverage as follows:

((Counted colonies * dilution factor) / Number of library members) * 1600

A coverage of >100x is ideal.

Note: 0.25 µl of the remaining 8 uL purified assembly mix is 32x used in this test. Electroporation with Endura typically yields in a 50x higher transformation efficiency compared to NEB Stable cells, meaning that the entire remaining 8 ul of the assembly mix has 32x50=1600x the number of colonies as the test transformation with 0.25 µl.
Determination of the Diversity
Perform colony PCR on 16 colonies from any of the dilution plates to determined the diversity of the cloned library, using the following conditions:

pX330_seqfw GAGGGCCTATTTCCCATGAT
111219_postPT_rv
CTAGGCACCGGATCAATTGC

PCR mix for one reaction:
AB
NEB OneTaq 2X Master Mix with Standard Buffer 12.5 µl
Forward Primer @20 µM0.25 µl
Reverse Primer @20 µM0.25 µl
Waterad 12 µl
PCR program:
ABCDEF
94 °C 94 °C 55°C 72 °C 72 °C 4 °C
30 sec15 sec30 sec60 sec5 min remaining
Repeat steps B-D for 35x
Load 5 µl of each PCR onto a 2% agarose gel with ethidium bromide and expect bands at 635 bp for successful cloning, while 850 bp indicates plasmid background. If >2 colonies have 850 bp, then re-clone.
Purify rest of the colony PCR via QIAquick PCR Purification Kit and send in for Sanger sequencing with primer pX330_seqfw (GAGGGCCTATTTCCCATGAT). Check the cloned sgRNAs for diversity and move on to the electroporation of the assembly mix into Endura cells.
Electroporation of Assembly Mix in Endura Cells
Add 2 uL of assembly mix to 25uL of Lucigen Endura electrocompetent cells, repeat 4x
Electroporate using the following parameters:
  • 1mm cuvette
  • 10 μF
  • 600 Ohms
  • 1800 Volts
Immediately add 1mL recovery media from Lucigen into the electroporation cuvette.
Gently pipet bacterial suspension into a 14 ml culture tube that already contains 1 ml of Lucigen recovery media
Incubate at 30°C for 1 hour while shaking.
In a 50 ml centrifugation tube, pool all 4 electroporation mixes together and mix well by swirling.
Take out 10 µl of the pooled electroporation mix and add to 1 ml of recovery medium. Plate out 20 and 100 µl of that dilution onto pre-warmed plates (40,000 and 8,000-fold dilution, respectively). Incubate at 30°C overnight and count colonies to determine the coverage (see step 7.5 for calculation).
Transfer the pooled electroporation mix into 400 ml LB medium supplied with 100 µg/ml ampicillin. Incubate at 30°C overnight while shaking.
Centrifuge bacterial suspension as 2x200 ml aliquotes. Maxi prep on one bacteria pellet and keep the other one as backup at -20°C.
Lentivirus Production
Production and Titration of Lentivirus
Day -1: Plate HEK293 cells for Transfection
Plate 4x15 cm plates with HEK293FT cells at 1.625*10^7 cells per 15-cm plate in 20 mL DMEM + 10% FBS each
Day 0: Transfection of Lentiviral Plasmid Library

Prepare 2 separate tubes with the following components (mix for 1x15 cm dish transfection).

Tube A
AB
OptiMEM4 ml
pMDLg/pRRE9.7 µg
pRSV-Rev6.5 µg
pcDNA3-VSV-G3.3 µg
Lentiviral Plasmid Library13 µg

Tube B
AB
OptiMEM4 ml
TransIT-Lenti Transfection Reagent98 µl
Combine tube A and B and mix by gently inverting. Incubate for 15 minutes at room temperature.
Gently add transfection mix dropwise to the cells.
Day 1: First Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 ml of DMEM+10% FBS.
Day 2: Second Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 ml of DMEM+10% FBS.
Day 3: Final Harvest and Lentivirus Concetration
Collect lentiviral supernatant and pool all lentivirus harvest together.
Centrifuge pooled lentiviral supernatant at 300xg for 5 minutes. Filter supernatant through a 0.45 µm filter and add 1/3 volume of Lenti-X Concentrator. Mix gently by inversion and incubate for 30 minutes or overnight at 4°C.
Centrifuge at 1,500xg for 45 minutes at 4°C.
Gently pour out the supernatant and resuspend pellet in 2 ml of DMEM+10% FBS per 15 cm. Aliquote 500 µl per cryotube and store at -80°C.
Titration of Lentivirus
Titrate the lentivirus on a 24 well plate using 8*10^4/well (4*10^4/cm2). Eventual experiment will use 6.25M (6.25*10^6) cells on a 15-cm (4*10^4/cm2). Each 24-well of titration uses ~1/75 as many cells as the 15-cm plate will.
Below is the standard lentivirus titration dose chart, although you can alter if necessary. Volumes are calculated for 4 mL total lenti and should be adjusted as necessary to account for fraction of lenti produced:
1/150 = 26.66 uL
1/300 = 13.33 uL
1/600 = 6.66 uL
1/1200 = 3.33 uL
1/1800 = 2.22 uL
1/2400 = 1.67 uL
1/4800 = 0.83 uL
Day 0: Plating and Infection of HepG2 Cells
Plate 80,000 HepG2 cells per well in a 24-well supplied with polybrene in a final concentration of 8 µg/ml. Add lentivirus in the dilution steps as stated above. Have two extra wells seeded with no virus as selection control.
Day 2: Start of Puromycin Selection
Replace medium with DMEM+10% FBS supplied with 500 ng/ml puromycin
Day 3: First Passage
Wash cells with PBS and add 75 µl of trypsin. Incubate for 5 minutes at 37°C and add 500 µl of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 5: Second Passage
Wash cells with PBS and add 75 µl of trypsin. Incubate for 5 minutes at 37°C and add 500 µl of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 7: Count
By now, control well with no virus should be completely dead. Count each well and detemine the lentiviral dose with the highest survival. The lentiviral dose with 50% survival from that is then the desired lentiviral dosage for the screen. Multiply the dosage with 75 to scale the lentiviral dosage to the 15 cm dish format.
Lentivirus Library Infection
Day 0: Infection of HepG2 Cells
Trypsinze and count HepG2 cells. Add 6.25x106 cells to a 15 ml centrifugation tube, add lentivirus library and mix by gently inverting. Plate mix onto 15 cm dish with a total medium volume of 20 ml supplied with 8 µg/ml polybrene.

Seed 410.000 HepG2 cells in a 6-well as selection control.
Day 1: VPA Treatment
Replace media with DMEM+10% FBS and 2mM VPA
Day 3: Start of Puromycin Selection
Replace medium with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin.
Day 4: First Passage
Split cells 1:2 to one new 15 cm dish with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin (ending up with one plate per replicate).
Day 6: Second Passage
Split cells 1:2 to two new 15 cm dish with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin (ending up with two plates per replicate). By now, control 6-well with no virus should be dead.
Day 8: Seed for LDL Uptake Screen
Seed 31.25x106 cells per replicate in a 15 cm dish. For bulk, seed 12,25x106 cells in a 10 cm dish. Seed both in DMEM+10% FBS.
Day 9: Serum Depravation
In the late afternoon, change medium to OptiMEM to start the serum depravation.
Day 10: Single RNA Seq - Gel Bead-in-Emulsion Preparation

10xGenomics Single Cell RNA Kit: GEM-X Universal 5' Gene Expression v3 4-plex (CG000772)

Cell Preparation
1. Get beads out of -80c to allow to equilibrate to room temperature (at least 30 minutes)
2. Chill 5 mL PBS in advance on ice.
3. Aspirate medium, add 10 ml of room temp PBS, wash by gently rocking the plate back and forth, and aspirate PBS completely
4. Add 4 ml of 0.25% Trypsin-EDTA, distribute the Trypsin across the entire plate by gently rocking the plate back and forth, and incubate in a humidified incubator for 5 minutes at 37°C
5. With a 10 ml serological pipet, add 8 ml of DMEM+10% FCS medium to the plate and hold the plate at a 30° angle facing towards you. Using the same 10 ml serological pipet, take up the cell suspension and discharge at the top of the plate. Repeat this rinsing motion a few times until the white viscous film is gone and cell suspension appears homogeneous. Transfer cell suspension into a 15 ml tube. Filter through 50-mL filter-cap FACS tube(s) then transfer back to 15 mL tube and centrifuge at 1,000 rpm for 5 minutes at 4°C.
6. Aspirate supernatant and resuspend in 1 ml ice-cold PBS+0.4%BSA with a 1000 ul pipette by gently pipetting up and down 10-15x. Add another 1 ml of ice-cold PBS+0.4% BSA.
7. Among 2 blue filter-cap FACS tubes, carefully apply about 500 ul of cell suspension onto the membrane of a blue cap FACS tube each and pulse spin for 10 seconds (centrifuge will hit about 2,300 rpm at the end). Cells will form a pellet at the bottom of each FACS tube.
8. Gently resuspend the pellet in the same supernatant by pipetting up and down with a 1000 ul pipet 10x and combine both in a single FACS tube.
9. With the 1000 ul pipette, push the cell suspension through the membrane of a fresh blue filter-cap FACS tube. Repeat until the entire cell suspension went through the filter.
10. Repeat step 6 again to ensure single cell suspension for processing. Keep cells on ice.
11. Count cells and make a fresh cell suspension with the concentration of 1,500 live cells per ul (1.5M cells per ml) in 1 ml total volume in PBS+0.4% in 5 ml tubes

Prepare Master Mix

  1. Add 7.2 ul of master mix into each tube of a 8-tube PCR strip on ice.

Assemble Chip Holder
  1. Get the gasket (light blue rubber part) - DO NOT TOUCH the smooth side of the gasket
  2. Attach the gasket by holding the tongue (curved end, to the right) and hook the gasket on the left-hand tabs of the holder. Gently pull the gasket toward the right and hook it on the two right-hand tabs.
  3. Open the chip holder
  4. Remove the chip from the sealed bag. Use the chip within less than 24 hours after opening.
  5. In the open chip holder, align the notch of the chip (upper left corner)
  6. Slide the chip to the left until the guide on the holder is inserted into the chip. Depress the right hand side of the chip until the spring-loaded chip engages (audible click sound)
  7. Keep the assembled unit with the attached gasket open until ready for and while dispensing reagents/cells into wells

Load GEM Chip

1. Ensure that the gel beads are equilibrated to room temperature 30 minutes before loading the chip

To the PCR strip holding the master mix prepared in step 1.3.1, add to each tube 4.3 ul of 1xPBS, mix by pipetting and centrifuge briefly
  1. Gently mix prepared stock cell suspensions (1,500 cells per ul) with a P1000 and add 5.5 ul of cell suspension into each tube of master mix and PBS (total volume 17 ul in each tube)
  2. Using a multi channel (P20), gently mix the master mix and cell suspension. Avoid bubbles!
  3. Using the same pipette tip, dispense 15 ul of master mix/cell suspension into the bottom center of each well in row labeled 1 without introducing bubbles
  4. Wait 30 sec and proceed with next step immediately

5. Using a multichannel pipette (P200), dispense 70 ul of Partitioning Oil B into wells in row labeled 3.

Run Chromium X Series
  1. Close the lid of the chip holder. DO NOT touch the smooth side of the gasket. DO NOT press down on the top of the gasket. Keep horizontal to avoid spillage and wetting the gasket.
  2. Press the eject button to eject the tray.
  3. Place the assembled chip in the tray. Press the button again to retract the tray
  4. Confirm GEM-X 5P OCM program on screen. Press the play button.
  5. Run will take about 4-5 minutes. Immediately proceed with the next step.
  6. Have a PCR tube strip ready on ice
  7. Press the eject button and remove the chip holder
  8. Discard the gasket. Open the chip holder and inspect the GEM.
  9. Fold the lid of the chip holder back until it clicks and expose the wells at 45 degrees.
  10. Slowly aspirate 100 ul GEMs from top row “No fill” Well 2.
  11. GEMs should appear opaque and uniform in both the recovery wells. Over the course of 20 sec, dispense GEMs into a tube of the pre-chilled PCR strip on ice with the pipette tip against the sidewall of the tube.

Reverse Transcription

Post GEM-RT Cleanup
  1. Add 125 ul Recovery Agent to each sample at room temperature. DO NOT pipette mix or vortex the biphasic mixture! Gently invert the tubes and Incubate for 2 minutes.
  2. The resulting biphasic mixture contains Recovery Agent/Partitioning Oil (pink) and aqueous phase (clear - this is your sample), with no persisting emulsion (opaque).
  3. Note: If the biphasic separation is incomplete:
  4. Firmly secure cap on the tube and mix by inverting tubes 5x, centrifuge briefly, and proceed with next step
  5. Slowly remove and discard 125 ul of recovery agent/partitioning oil (pink) from the bottom of the tube. DO NOT aspirate any aqueous sample.
  6. Prepare Dynabeads Cleanup mix
  7. Vortex Dynabeads for about 30 sec immediately before adding to the mix
  8. Pipette full liquid volume in the Dynabead tube with a pipette tip to verify that beads have not settled. If clumps are present, pipette mix to resuspend completely. DO NOT centrifuge!
  9. Prepare master mix according to 1x shown below:

Vortex cleanup mix and add 200 ul of mix to each sample tube. Pipette mix 10x.
  1. Incubate for 10 min at room temperature (keep caps open). Pipette mix again 5 minutes after start of incubation.
  2. In the meantime, prepare elution solution 1. See mix below:

After the 10 minutes incubation, place tubes into a 10x magnetic separator (high position) until solution clears (or about 5 minutes)
  1. Remove supernatant
  2. Add 300 ul of 80% Ethanol to the bead pellet while on the magnet. Incubate for 30 sec
  3. Remove ethanol
  4. Add 200 ul of 80% Ethanol to the bead pellet while on the magnet. Incubate for 30 sec
  5. Remove ethanol
  6. Centrifuge briefly. Place on the 10x magnetic separator (low position)
  7. Carefully remove remaining ethanol with a P10 or P20. Air dry for 1 min.
  8. Remove tube from the magnet and add 35.5 ul Elution Solution 1.
  9. Gently pipette mix for 15x. There should be no clumps left - if so, keep pipetting until fully resuspended.
  10. Incubate for 1 minute at room temperature
  11. Place tube on the magnet (low position) until the solution clears (or 5 minutes)
  12. Transfer 35 ul sample to a new PCR tube. Proceed with cDNA amplification.

cDNA Amplification

1. Add 65 ul cDNA Amplification Reaction mix to the 35 ul sample (cleaned up earlier) and pipette mix 15x. If necessary, centrifuge briefly.
2. Run samples in a thermocycler with the following program


cDNA Cleanup - SPRIselect
  1. Vortex and resuspend the SPRI beads. Add 60 ul of SPRI beads (0.6x) to each sample and mix 15x by pipetting.
  2. Incubate for 5 minutes
  3. Place tube on magnet
  4. Transfer 75 ul of supernatant to a new tube without disturbing the pellet. Keep supernatant on ice. Save the other 85 ul as back up. Keep tube with the beads on the magnet. DO NOT discard the pellet! Immediately proceed to the pellet cleanup.

Pellet Clean Up - Gene Expression
  1. Add 200 ul of 80% Ethanol to the pellet. Incubate for 30 seconds.
  2. Remove ethanol carefully
  3. Add 200 ul of 80% Ethanol to the pellet. Incubate for 30 seconds.
  4. Remove ethanol carefully (total of 2 washes)
  5. Centrifuge briefly and place tube back into magnet
  6. Carefully remove remaining ethanol with a P10 or P20. Air dry for 2 minutes. Do not exceed 2 minutes!
  7. Remove tube from magnet and resuspend in 40.5 ul EB buffer. Mix by pipetting 15x (pipet set to 35 ul)
  8. Incubate for 2 minutes
  9. Place tube back into magnet and incubate for 5 minutes
  10. Transfer 40 ul of supernatant to a new tube. Keep sample on ice.

Transfer Supernatant Clean Up - CRISPR
  1. Vortex and resuspend the SPRI beads. Add 30 ul of SPRI beads to each of the 75 ul transferred supernatants (1.2x) and mix 15x by pipetting.
  2. Incubate for 5 minutes
  3. Place tube on magnet
  4. Remove supernatant
  5. Add 200 ul of 80% Ethanol to the pellet. Incubate for 30 seconds.
  6. Remove ethanol carefully
  7. Add 200 ul of 80% Ethanol to the pellet. Incubate for 30 seconds.
  8. Remove ethanol carefully (total of 2 washes)
  9. Centrifuge briefly and place tube back into magnet
  10. Carefully remove remaining ethanol with a P10 or P20. Air dry for 2 minutes. Do not exceed 2 minutes!
  11. Remove from magnet and resuspend pellet in 50.5 ul EB buffer by pipetting 15x (pipet set to 35 ul)
  12. Incubate for 2 minutes at room temperature
  13. Place tube back into the magnet and incubate for 5 minutes
  14. Transfer 50 ul supernatant of sample to a new tube.
Gene Expression Library Construction
Prepare a thermal cycler with the following incubation protocol:

  1. Vortex Fragmentation buffer. Verify there is no precipitate.
  2. Prepare Fragmentation mix on ice. Add reagents in the order listed. Pipette mix and centrifuge briefly.
  3. Transfer only 10 ul of the cDNA sample of the Gene Expression clean up (pellet cleanup, from step 2.4.1 earlier) to a new PCR strip. Store the remaining cDNA sample at -20c.
  4. Add 40 ul of the Fragmentation mix to each of 10 ul samples.
  5. Pipette mix 15x on ice.
  6. Transfer into pre-cooled thermocycler (at 4c) and press resume to start reaction.

GEX Post Fragmentation, End Repair & A-tailing Double Sided - SPRI select
  1. Vortex to resuspend SPRI beads. Add 30 ul of breads (0.6x) to each sample. Mix by pipetting 15x
  2. Incubate for 5 minutes at room temperature
  3. Place on magnet and incubate for 5 minutes
  4. Remove 80 ul supernatant. DO NOT discard any beads!
  5. With the tube still on the magnet, add 125 ul 80% Ethanol and incubate for 30 seconds
  6. Remove ethanol
  7. With the tube still on the magnet, add 125 ul 80% Ethanol and incubate for 30 seconds
  8. Remove ethanol (total 2 wash steps)
  9. Centrifuge briefly and place tubes back on the magnet
  10. Carefully remove remaining ethanol and air dry for 1 minute
  11. Remove tube from magnet and resuspend in 50.5 ul EB Buffer by pipetting 15x
  12. Incubate for 2 minutes
  13. Place tube back on the magnet and incubate for 5 minutes
  14. Transfer 50 ul of supernatant to a new PCR tube

GEX Adaptor Ligation
Prepare Adaptor ligation mix.

Add 50 ul of Adapter ligation mix to 50 ul of sample. Mix by pipetting 15x
  1. Incubate samples in a thermocycler with the following settings

GEX Post Ligation Cleanup - SPRIselect
  1. Vortex SPRI beads and add 80 ul of beads (0.8x) to each Gene expression sample (post ligation) and mix via pipetting for 15x
  2. Incubate for 5 minutes at room temperature
  3. Place tube in magnet and incubate for 5 minutes
  4. Carefully remove supernatant
  5. Add 200 ul 80% Ethanol and incubate for 30 seconds
  6. Remove ethanol.
  7. Add 200 ul 80% Ethanol and incubate for 30 seconds
  8. Remove ethanol (total wash steps of 2)
  9. Centrifuge briefly and place tubes back on the magnet
  10. Carefully remove any remaining ethanol with either at P10 or P20. Air dry for 2 minutes.
  11. Remove tube from magnet and resuspend in 30.5 ul EB buffer and mix via pipetting 15x
  12. Incubate for 2 minutes
  13. Place tube back into magnet and incubate for 5 minutes
  14. Carefully transfer 30 ul supernatant to a new tube.

Perform the following qPCR:
· First, mix 0.3 uL of eluted library with 1.2 uL of Elution Solution (or dH2O). This will give a 5x dilution of sample and allow for repeat qPCRs if necessary without depleting more precious sample in case something goes wrong. Then, prepare the following qPCR:
10 uL 2X Q5 mastermix
1 uL 20X EvaGreen
0.5 uL 20 uM 092922_P5_anchor AATGATACGGCGACCACCGAGA
0.5 uL 20 uM NEBNext i7 index primer (note that any i7 primer is OK)
0.5 uL 5x-diluted scRNA-seq-seq library
7.5 uL dH20
Perform the following qPCR protocol
98 deg for 45s
25 cycles of:
98 deg for 20s
54 deg for 30s
72 deg for 20s
Then:
72 deg for 60s
4 deg forever
Run the qPCR product on a 2% EtBr gel after it plateaus.
In this qPCR, we use 0.5 uL of a 5x diluted, so equivalent of 0.1 uL of template. For the actual PCR you will use 30 uL. This means we are using 300x less template than we will in the actual PCR. 300=2^~8, so your qPCR will come up 8 cycles later than you would expect your PCR with 30 uL input to come up. Usually, you would run a PCR to the middle to latter half of the exponential phase, so in this case, find the middle to latter half of the exponential phase and subtract 8 cycles to determine PCR cycle count. Hopefully it comes to a similar cycle count to what is recommended in the 10x protocol.

GEX Sample Index PCR
Choose the appropriate sample index sets to ensure that no sample indices overlap in a multiplexed sequencing run. Record the 10x sample index name (PN-3000431 Dual Index Plate TT Set A well ID) used. See list below:
index_nameindex(i7)index2_workflow_a(i5)index2_workflow_b(i5)
SI-TT-A1GTAACATGCGAGTGTTACCTAGGTAACACT
SI-TT-A2GTGGATCAAAGCCAACCCTGCAGGGTTGGC
SI-TT-A3CACTACGAAATTAGACTGATATCAGTCTAA
SI-TT-A4CTCTAGCGAGTATCTTCATCGATGAAGATA
SI-TT-A5GTAGCCCTGTGAGCATCTATATAGATGCTC
SI-TT-A6TAACGCGTGACCCTAACTTCGAAGTTAGGG
SI-TT-A7TCCCAAGGGTTACTACCTTTAAAGGTAGTA
SI-TT-A8CGAAGTATACGAACTTGGAGCTCCAAGTTC
SI-TT-A9AAGTGGAGAGTTCCTGTTACGTAACAGGAA
SI-TT-A10CGTGACATGCATGGTCTAAATTTAGACCAT
SI-TT-A11CGGAACCCAAGATTCGAGGATCCTCGAATC
SI-TT-A12CACCGCACCAGACTGTCAATATTGACAGTC
SI-TT-B1ACAGTAACTAACAGTTCGTTAACGAACTGT
SI-TT-B2TCTACCATTTCGGGAGAGTCGACTCTCCCG
SI-TT-B3CACGGTGAATGTTCGTCACATGTGACGAAC
SI-TT-B4GTAGACGAAACTAGTGTGGTACCACACTAG
SI-TT-B5TCGGCTCTACCCGATGGTCTAGACCATCGG
SI-TT-B6AATGCCATGATACGTAATGCGCATTACGTA
SI-TT-B7GCCTTCGGTACCAACGATTTAAATCGTTGG
SI-TT-B8GCACTGAGAATATGCGTGAATTCACGCATA
SI-TT-B9TATTGAGGCACAGGTAAGTGCACTTACCTG
SI-TT-B10GCCCGATGGAAATCGTCTAGCTAGACGATT
SI-TT-B11TCTTACTTGCTGACCTCTAGCTAGAGGTCA
SI-TT-B12CGTCAAGGGCTAGGTCACTCGAGTGACCTA
SI-TT-C1TGCGCGGTTTCAAGGATAAATTTATCCTTG
SI-TT-C2CAATCCCGACCCGAGTAGTATACTACTCGG
SI-TT-C3ATGGCTTGTGGAATGTTGTGCACAACATTC
SI-TT-C4TTCTCGATGATGTCGGGCACGTGCCCGACA
SI-TT-C5TCCGTTGGATACGTTCTCGCGCGAGAACGT
SI-TT-C6ACGACTACCAACGACCCTAATTAGGGTCGT
SI-TT-C7CGCGCACTTACCTGTATTCTAGAATACAGG
SI-TT-C8GCTACAAAGCCACGTGCCCTAGGGCACGTG
SI-TT-C9TATCAGCCTAGTTTCGTCCTAGGACGAAAC
SI-TT-C10AGAATGGTTTGAGGGTGGGATCCCACCCTC
SI-TT-C11ATGGGTGAAACTTGGGAATTAATTCCCAAG
SI-TT-C12TCGTCAAGATGCAACTCAGGCCTGAGTTGC
SI-TT-D1TGCAATGTTCGCTTGTCGAATTCGACAAGC
SI-TT-D2TTAATACGCGCACCTCGGGTACCCGAGGTG
SI-TT-D3CCTTCTAGAGAATACAACGATCGTTGTATT
SI-TT-D4GCAGTATAGGTTCCGTGCACGTGCACGGAA
SI-TT-D5TGGTTCGGGTGTGGCAGGAGCTCCTGCCAC
SI-TT-D6CCCAGCTTCTGACACCAAACGTTTGGTGTC
SI-TT-D7CCTGTCAGGGAGCCCGTAACGTTACGGGCT
SI-TT-D8CGCTGAAATCAGGTGTCTGCGCAGACACCT
SI-TT-D9TGGTCCCAAGCCTCTGGCGTACGCCAGAGG
SI-TT-D10ATGCGAATGGACAAGTGTCGCGACACTTGT
SI-TT-D11CGAATATTCGCTGGAAGCAATTGCTTCCAG
SI-TT-D12GAATTGGTTAACTCTAGTAGCTACTAGAGT
SI-TT-E1TTATTCGAGGCTGTCCTGCTAGCAGGACAG
SI-TT-E2ATGGAGGGAGATAACCCATTAATGGGTTAT
SI-TT-E3ACCAGACAACAGGAACTAGGCCTAGTTCCT
SI-TT-E4AACCACGCATATTCAGGTTATAACCTGAAT
SI-TT-E5CGCGGTAGGTCAGGATGTTGCAACATCCTG
SI-TT-E6TTGAGAGTCAAACCTGGTAGCTACCAGGTT
SI-TT-E7GTCCTTCGGCTCATGCACAGCTGTGCATGA
SI-TT-E8GAGCAAGGGCATTGACTTGGCCAAGTCAAT
SI-TT-E9TGTCCCAACGTCGATGTCCATGGACATCGA
SI-TT-E10CACAATCCCAATATCCACAATTGTGGATAT
SI-TT-E11TCCGGGACAAGTGAATGCCATGGCATTCAC
SI-TT-E12CGTCCACCTGCATTCATGACGTCATGAATG
SI-TT-F1AAGATTGGATAGCGGGATTTAAATCCCGCT
SI-TT-F2AAGGGCCGCACTGATTCCTCGAGGAATCAG
SI-TT-F3GAGAGGATATTTGAAATGGGCCCATTTCAA
SI-TT-F4CCCACCACAAACCTCCGCTTAAGCGGAGGT
SI-TT-F5CGGCTGGATGTGATAAGCACGTGCTTATCA
SI-TT-F6TTGCCCGTGCGCGTGAGATTAATCTCACGC
SI-TT-F7AATGTATCCAAATGAGCTTATAAGCTCATT
SI-TT-F8CTCCTTTAGAGACATAGCTCGAGCTATGTC
SI-TT-F9GTCCCATCAACGAACGTGACGTCACGTTCG
SI-TT-F10CCGGCAACTGCGGTTTAACATGTTAAACCG
SI-TT-F11TTCACACCTTTAGTGTACACGTGTACACTA
SI-TT-F12GAGACGCACGCTATGAACATATGTTCATAG
SI-TT-G1TGTAGTCATTCTTGATCGTATACGATCAAG
SI-TT-G2CATGTGGGTTGATTCCTTTATAAAGGAATC
SI-TT-G3ATGACGTCGCAGGTCAGGATATCCTGACCT
SI-TT-G4GCGCTTATGGGCCTGGCTAGCTAGCCAGGC
SI-TT-G5ATAGGGCGAGTGCATCGAGTACTCGATGCA
SI-TT-G6GCGGGTAAGTTAGCACTAAGCTTAGTGCTA
SI-TT-G7GTTTCACGATTTCGGCCAAATTTGGCCGAA
SI-TT-G8TAAGCAACTGCTATACTCAATTGAGTATAG
SI-TT-G9CCGGAGGAAGTGCGGATGTTAACATCCGCA
SI-TT-G10ACTTTACGTGTGAACGCCCTAGGGCGTTCA
SI-TT-G11GATAACCTGCCATTAGAAACGTTTCTAATG
SI-TT-G12CTTGCATAAAATCAGGGCTTAAGCCCTGAT
SI-TT-H1ACAATGTGAACGTACCGTTATAACGGTACG
SI-TT-H2TAGCATAGTGCGGCTCTGTCGACAGAGCCG
SI-TT-H3CCCGTTCTCGGACGGATTGGCCAATCCGTC
SI-TT-H4AGTTTCCTGGTGCCACACAGCTGTGTGGCA
SI-TT-H5AGCAAGAAGCTTGTGTTTCTAGAAACACAA
SI-TT-H6CCTATCCTCGGAATACTAACGTTAGTATTC
SI-TT-H7ACCTCGAGCTTGTGTTCGATATCGAACACA
SI-TT-H8ATAAGGATACATAGATAGGGCCCTATCTAT
SI-TT-H9AGAACTTAGACGAGTCCTTTAAAGGACTCG
SI-TT-H10TTATCTAGGGAAAGGCTCTATAGAGCCTTT
SI-TT-H11ACAATCGATCTGACGGAATGCATTCCGTCA
SI-TT-H12TGATGATTCAGTAGGAGTCGCGACTCCTAC
  1. Add 50 ul Amp Mix (PN-2000047/2000103) or Library Amp Mix (PN-2000531) (either of them will work for gene expression library construction) to 30 ul of sample.
  2. Add 20 ul of an individual Dual Index TT Set A to each sample and note the well ID used. Pipette mix 5x
Run the following program, note that the cycle number has to be adjusted to the cDNA input (see section 2.5 Post cDNA Amplification QC and Quantification - Gene Expression Part Only - in short: 25% of the total cDNA yield is the input cDNA)

Post Sample Index PCR Double Sided Size Selection - SPRIselect
  1. Vortex to resuspend the SPRI beads and add 60 ul SPRI beads (0.6x) to each sample and pipet mix for 15x
  2. Incubate for 5 minutes
  3. Place tube in magnet and incubate for 5 minutes
  4. Transfer 150 ul of supernatant to a new tube (Keep the supernatant!)
  5. Vortex to resuspend the SPRI beads and add 20 ul SPRI beads (0.8x) to the transferred supernatant and pipet mix for 15x
  6. Incubate for 5 minutes
  7. Place tube into magnet and incubate for 5 minutes
  8. Remove 165 ul supernatant. DO NOT discard any beads!
  9. With the tube still in the magnet, add 200 ul of 80% Ethanol to the pellet and incubate for 30 seconds.
  10. Remove the ethanol
  11. With the tube still in the magnet, add 200 ul of 80% Ethanol to the pellet and incubate for 30 seconds.
  12. Remove the ethanol (total of 2 wash steps)
  13. Centrifuge briefly. Place tube back into the magnet.
  14. Carefully remove residual ethanol with a P10 or P20. Air dry for 1 minute
  15. Remove tube from magnet. Resuspend beads in 35.5 ul EB Buffer by pipetting 15x
  16. Incubate for 2 minutes
  17. Place tube on the magnet and incubate for 5 minutes
  18. Transfer 35 ul of supernatant to a new tube.
  19. Run sample on D1000 Tapestation and verify clean peak at around 400 bp
CRISPR Screening Library Construction
Guide RNA cDNA Cleanup - SPRIselect
  1. Vortex SPRI beads and add 50 ul of beads (1x) to 50 ul transferred supernatant cleanup from step (xxX) and mix via pipetting 15x.
  2. Incubate for 5 minutes
  3. Place on magnet and incubate for 5 minutes
  4. Remove supernatant
  5. Add 200 ul of 80% Ethanol to the pellet and incubate for 30 seconds
  6. Remove Ethanol.
  7. Add 200 ul of 80% Ethanol to the pellet and incubate for 30 seconds
  8. Remove Ethanol (total of 2 wash steps)
  9. Carefully remove any remaining ethanol. Air dry for 2 minutes
  10. Remove tube from magnet and resuspend pellet in 40.5 ul EB Buffer.
  11. Incubate for 2 minutes
  12. Place tube on magnet and incubate for 5 minutes
  13. Transfer 40 ul of supernatant to new tube.


Feature PCR
  1. Prepare the following mix on ice.

1. Transfer only 5 ul from the Guide RNA cDNA cleanup to a PCR tube and add 95 ul of Feature PCR mix. Gently mix via pipetting.
2. Run samples with the following PCR program:

Post Feature PCR Cleanup - SPRIselect
  1. Vortex SPRI beads and add 100 ul of beads to sample. Mix via pipetting 15x
  2. Incubate for 5 minutes at room temperature
  3. Place tube in magnet and incubate for 5 minutes
  4. Remove supernatant
  5. Add 300 ul of 80% Ethanol and incubate for 30 seconds
  6. Remove ethanol.
  7. Add 300 ul of 80% Ethanol and incubate for 30 seconds
  8. Remove ethanol (total of 2 wash steps)
  9. Carefully remove any remaining ethanol. Air dry for 2 minutes
  10. Remove tube from magnet and resuspend in 30.5 ul EB buffer by pipetting 15x
  11. Incubate for 2 minutes
  12. Place tube in magnet and incubate for 5 minutes
  13. Transfer 30 ul supernatant to a fresh tube.

Sample Index PCR
Choose the appropriate sample index sets to ensure that no sample indices overlap in a multiplexed sequencing run. Record the 10x sample index name (PN-3000431 Dual Index Plate TT Set A well ID) used. See list below:

index_nameindex(i7)index2_workflow_a(i5)index2_workflow_b(i5)
SI-TT-A1GTAACATGCGAGTGTTACCTAGGTAACACT
SI-TT-A2GTGGATCAAAGCCAACCCTGCAGGGTTGGC
SI-TT-A3CACTACGAAATTAGACTGATATCAGTCTAA
SI-TT-A4CTCTAGCGAGTATCTTCATCGATGAAGATA
SI-TT-A5GTAGCCCTGTGAGCATCTATATAGATGCTC
SI-TT-A6TAACGCGTGACCCTAACTTCGAAGTTAGGG
SI-TT-A7TCCCAAGGGTTACTACCTTTAAAGGTAGTA
SI-TT-A8CGAAGTATACGAACTTGGAGCTCCAAGTTC
SI-TT-A9AAGTGGAGAGTTCCTGTTACGTAACAGGAA
SI-TT-A10CGTGACATGCATGGTCTAAATTTAGACCAT
SI-TT-A11CGGAACCCAAGATTCGAGGATCCTCGAATC
SI-TT-A12CACCGCACCAGACTGTCAATATTGACAGTC
SI-TT-B1ACAGTAACTAACAGTTCGTTAACGAACTGT
SI-TT-B2TCTACCATTTCGGGAGAGTCGACTCTCCCG
SI-TT-B3CACGGTGAATGTTCGTCACATGTGACGAAC
SI-TT-B4GTAGACGAAACTAGTGTGGTACCACACTAG
SI-TT-B5TCGGCTCTACCCGATGGTCTAGACCATCGG
SI-TT-B6AATGCCATGATACGTAATGCGCATTACGTA
SI-TT-B7GCCTTCGGTACCAACGATTTAAATCGTTGG
SI-TT-B8GCACTGAGAATATGCGTGAATTCACGCATA
SI-TT-B9TATTGAGGCACAGGTAAGTGCACTTACCTG
SI-TT-B10GCCCGATGGAAATCGTCTAGCTAGACGATT
SI-TT-B11TCTTACTTGCTGACCTCTAGCTAGAGGTCA
SI-TT-B12CGTCAAGGGCTAGGTCACTCGAGTGACCTA
SI-TT-C1TGCGCGGTTTCAAGGATAAATTTATCCTTG
SI-TT-C2CAATCCCGACCCGAGTAGTATACTACTCGG
SI-TT-C3ATGGCTTGTGGAATGTTGTGCACAACATTC
SI-TT-C4TTCTCGATGATGTCGGGCACGTGCCCGACA
SI-TT-C5TCCGTTGGATACGTTCTCGCGCGAGAACGT
SI-TT-C6ACGACTACCAACGACCCTAATTAGGGTCGT
SI-TT-C7CGCGCACTTACCTGTATTCTAGAATACAGG
SI-TT-C8GCTACAAAGCCACGTGCCCTAGGGCACGTG
SI-TT-C9TATCAGCCTAGTTTCGTCCTAGGACGAAAC
SI-TT-C10AGAATGGTTTGAGGGTGGGATCCCACCCTC
SI-TT-C11ATGGGTGAAACTTGGGAATTAATTCCCAAG
SI-TT-C12TCGTCAAGATGCAACTCAGGCCTGAGTTGC
SI-TT-D1TGCAATGTTCGCTTGTCGAATTCGACAAGC
SI-TT-D2TTAATACGCGCACCTCGGGTACCCGAGGTG
SI-TT-D3CCTTCTAGAGAATACAACGATCGTTGTATT
SI-TT-D4GCAGTATAGGTTCCGTGCACGTGCACGGAA
SI-TT-D5TGGTTCGGGTGTGGCAGGAGCTCCTGCCAC
SI-TT-D6CCCAGCTTCTGACACCAAACGTTTGGTGTC
SI-TT-D7CCTGTCAGGGAGCCCGTAACGTTACGGGCT
SI-TT-D8CGCTGAAATCAGGTGTCTGCGCAGACACCT
SI-TT-D9TGGTCCCAAGCCTCTGGCGTACGCCAGAGG
SI-TT-D10ATGCGAATGGACAAGTGTCGCGACACTTGT
SI-TT-D11CGAATATTCGCTGGAAGCAATTGCTTCCAG
SI-TT-D12GAATTGGTTAACTCTAGTAGCTACTAGAGT
SI-TT-E1TTATTCGAGGCTGTCCTGCTAGCAGGACAG
SI-TT-E2ATGGAGGGAGATAACCCATTAATGGGTTAT
SI-TT-E3ACCAGACAACAGGAACTAGGCCTAGTTCCT
SI-TT-E4AACCACGCATATTCAGGTTATAACCTGAAT
SI-TT-E5CGCGGTAGGTCAGGATGTTGCAACATCCTG
SI-TT-E6TTGAGAGTCAAACCTGGTAGCTACCAGGTT
SI-TT-E7GTCCTTCGGCTCATGCACAGCTGTGCATGA
SI-TT-E8GAGCAAGGGCATTGACTTGGCCAAGTCAAT
SI-TT-E9TGTCCCAACGTCGATGTCCATGGACATCGA
SI-TT-E10CACAATCCCAATATCCACAATTGTGGATAT
SI-TT-E11TCCGGGACAAGTGAATGCCATGGCATTCAC
SI-TT-E12CGTCCACCTGCATTCATGACGTCATGAATG
SI-TT-F1AAGATTGGATAGCGGGATTTAAATCCCGCT
SI-TT-F2AAGGGCCGCACTGATTCCTCGAGGAATCAG
SI-TT-F3GAGAGGATATTTGAAATGGGCCCATTTCAA
SI-TT-F4CCCACCACAAACCTCCGCTTAAGCGGAGGT
SI-TT-F5CGGCTGGATGTGATAAGCACGTGCTTATCA
SI-TT-F6TTGCCCGTGCGCGTGAGATTAATCTCACGC
SI-TT-F7AATGTATCCAAATGAGCTTATAAGCTCATT
SI-TT-F8CTCCTTTAGAGACATAGCTCGAGCTATGTC
SI-TT-F9GTCCCATCAACGAACGTGACGTCACGTTCG
SI-TT-F10CCGGCAACTGCGGTTTAACATGTTAAACCG
SI-TT-F11TTCACACCTTTAGTGTACACGTGTACACTA
SI-TT-F12GAGACGCACGCTATGAACATATGTTCATAG
SI-TT-G1TGTAGTCATTCTTGATCGTATACGATCAAG
SI-TT-G2CATGTGGGTTGATTCCTTTATAAAGGAATC
SI-TT-G3ATGACGTCGCAGGTCAGGATATCCTGACCT
SI-TT-G4GCGCTTATGGGCCTGGCTAGCTAGCCAGGC
SI-TT-G5ATAGGGCGAGTGCATCGAGTACTCGATGCA
SI-TT-G6GCGGGTAAGTTAGCACTAAGCTTAGTGCTA
SI-TT-G7GTTTCACGATTTCGGCCAAATTTGGCCGAA
SI-TT-G8TAAGCAACTGCTATACTCAATTGAGTATAG
SI-TT-G9CCGGAGGAAGTGCGGATGTTAACATCCGCA
SI-TT-G10ACTTTACGTGTGAACGCCCTAGGGCGTTCA
SI-TT-G11GATAACCTGCCATTAGAAACGTTTCTAATG
SI-TT-G12CTTGCATAAAATCAGGGCTTAAGCCCTGAT
SI-TT-H1ACAATGTGAACGTACCGTTATAACGGTACG
SI-TT-H2TAGCATAGTGCGGCTCTGTCGACAGAGCCG
SI-TT-H3CCCGTTCTCGGACGGATTGGCCAATCCGTC
SI-TT-H4AGTTTCCTGGTGCCACACAGCTGTGTGGCA
SI-TT-H5AGCAAGAAGCTTGTGTTTCTAGAAACACAA
SI-TT-H6CCTATCCTCGGAATACTAACGTTAGTATTC
SI-TT-H7ACCTCGAGCTTGTGTTCGATATCGAACACA
SI-TT-H8ATAAGGATACATAGATAGGGCCCTATCTAT
SI-TT-H9AGAACTTAGACGAGTCCTTTAAAGGACTCG
SI-TT-H10TTATCTAGGGAAAGGCTCTATAGAGCCTTT
SI-TT-H11ACAATCGATCTGACGGAATGCATTCCGTCA
SI-TT-H12TGATGATTCAGTAGGAGTCGCGACTCCTAC
  1. Add 50 μl Amp Mix (PN-200047) to 30 μl sample (Post Feature PCR Cleanup).
  2. Add 20 ul of an individual Dual Index TT Set A to each sample and note the well ID used. Pipette mix 5x

Re-Amplify CRISPR Library

Read1 primer
10xGen_FeatureSI_Read1 GATCTACACTCTTTCC CTACACGACGC
Tm= 49c
Read2 primers
062425_10xgRNAhp_r2seqB (O3869) GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CAAGTTGATAACGGACTAGCCTTATT
Tm= 64c

  1. Prepare the following qPCR
10 uL 2X Q5 mastermix
1 uL 20X EvaGreen
0.5 uL 20 uM 062425_10xgRNAhp_r2seqB (O3869)
0.5 ul 20 uM 10xGen_FeatureSI_Read1
0.5 uL 10x gRNA library
7.5 uL dH20

Perform the following qPCR protocol
98 deg for 30s
35 cycles of:
98 deg for 10s
62 deg for 30s
72 deg for 30s
Then:
72 deg for 60s
4 deg forever

Optional
  1. PCR purify
  2. Run 1 uL of each reaction on D1000 Tapestation. We are looking for a spike at ~200-250 nt (note that this is shorter than the full product because you have only added partial adapters
  3. The goal is to identify the gRNA primer that is most efficient (low Ct) and specific (highest ratio of product in the correctly sized spike)
  4. Cycle number for PCR1 is dependent on qPCR - ideally, choose cycle number 2-3 cycles before the plateau phase

Perform PCR1

  1. Prepare the following PCR reaction:
50 uL 2X Q5 mastermix
2.5 uL 20 uM 10xGen_FeatureSI_Read1
2.5 uL 20 uM 062425_10xgRNAhp_r2seqB (O3869)
30 uL 10x gRNA library
15 uL dH20

  1. Perform the following PCR protocol
98 deg for 30s
Number of cycles optimized in qPCR (2-3 cycles before plateau)
98 deg for 10s
62 deg for 30s
72 deg for 30s
Then:
72 deg for 60s
4 deg forever

Load PCR1 onto a 2%gel. Because of the 100 ul volume, carefully distribute the PCR sample along 2 wells of a 12 well comb. Carefully cut around the 200 bp band and gel purify.

Perform qPCR2 to determine PCR2 cycle number
  1. Prepare the following qPCR reaction:
10 uL 2X Q5 mastermix
1 uL 20X EvaGreen
0.5 uL 20 uM NEBNext i5 index primer (note that any i5 primer is OK)
0.5 uL 20 uM NEBNext i7 index primer (note that any i7 primer is OK)
0.5 uL 10x gRNA library PCR1 (from step 4b 4)
7.5 uL dH20


Perform the following qPCR protocol
98 deg for 30s
35 cycles of:
98 deg for 10s
72 deg for 30s
Then:
72 deg for 60s
4 deg forever

You can stop the qPCR once reaction plateaus.

  • Determine the plateau phase and subtract 2-3 cycles to find the optimal cycle number for PCR2

Perform PCR2

  1. Prepare the following PCR reaction:
25 uL 2X Q5 mastermix
1.25 uL 20 uM NEBNext i5 index primer (note which i5 is used for NGS sheet)
1.25 uL 20 uM NEBNext i7 index primer (note which i7 is used for NGS sheet)
2 uL 10x gRNA library
20.5 ul Water

  1. Perform the following PCR protocol
98 deg for 30s
XX cycles of:
98 deg for 10s
72 deg for 30s
Then:
72 deg for 60s
4 deg forever

  1. Perform SPRI clean up using either 1-sided or 2-sided procedure pending qPCR Tapestation result. Protocol below will have to be updated.
§ To the PCR reaction, add XX ul of mixed, ROOM TEMP, SPRI beads to each sample (this is a XX SPRI).
§ Vortex briefly and incubate for 5min at room temp
§ Apply magnet to collect beads
§ Once solution is clear, use pipette to remove supernatant
§ While still on magnet, add 180ul of 80% ETOH to each sample without mixing
§ Incubate for 30 sec at room temperature
§ Remove supernatant with pipette
§ Repeat steps EtOH wash steps for a second ethanol wash
§ Allow tubes to sit at room temp so the residual ethanol can evaporate, beads will turn from shiny to matte when dry (2-5 min), then proceed
§ With tubes off the magnet, add 20ul DNA Purification Elution Buffer
§ Cap tubes and mix by vortexing
§ Incubate samples for 5 min at room temp
§ Apply magnet to samples
§ Transfer 20 uL supernatant to a fresh labeled tube.

Perform Tapestation D1000 to quantify product. You may have to perform further bead purification to ensure clean product peak.