Jul 12, 2024
  • 1Pennsylvania State University
Icon indicating open access to content
QR code linking to this content
Protocol CitationRobert Nichols 2024. 16S and GyrB bacterial amplification. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgq31nylk5/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 03, 2024
Last Modified: July 12, 2024
Protocol  Integer ID: 92918
Keywords: PCR, gyrB, PacBio, MiSeq, amplification of the bacterial gyrb gene, bacterial gyrb gene, gyrb bacterial amplification this protocol, specificity of the gyrb phylogenetic marker gene, gyrb phylogenetic marker gene, bacterial amplification, gene for both pacbio sequel ii, sequencing, sequencing increase, gyrb, pacbio sequel ii, gene
Abstract
This protocol is used for the amplification of the bacterial gyrB gene and the 16S gene for both PacBio Sequel II and Illumina MiSeq sequencing. This protocol is used in the paper titled Long-read Sequencing Increases the Accuracy and Specificity of the gyrB Phylogenetic Marker Gene.

Materials
  • Isolated bacterial DNA
  • Nuclease-free water (VWR Cat # 103307-278)
  • Invitrogen Platinum SuperFi PCR Master Mix (ThermoFisher Scientific, Cat # 12368250)
  • 1 × TAE (Tris base [Millipore Sigma, Cat # 648311], acetic acid [Millipore Sigma, Cat # 695092], and EDTA [Millipore Sigma, Cat # E9884]) buffer
  • Omnipur agarose (VWR, Cat # EM-2070 )
  • GelRed dye (VWR, Cat# 10098-684)
  • 6× Gel loading dye, no SDS (Biolabs, Cat# B7025S)
  • 100-bp DNA ladder (VWR, Cat# PAG2101)
  • Ice bath
  • NanoDrop UV-Vis Spectrophotometer Lite (Thermo-Scientific)
  • Sterile 0.2-ml thin-wall PCR Tubes, strips of 8 tubes (Denville)
  • Sterile 0.5- to 10-μl pipettes (Denville)
  • Sterile 10- to 200-μl pipettes (Denville)
  • Sterile 1000-μl pipettes (Denville)
  • T100 Thermal cycler (Bio rad)
  • Gel electrophoresis box (Labnet)
  • ChemiDoc XRS+ (BioRad)


Primer info
ABCD
Primer NamePrimer DescriptioonPrimer Sequence Platform
V4_16S_FForward primer for V4 16S sequencingTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA MiSeq
V4_16S_RReverse primer for V4 16S sequencingGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACNVGGGTWTCTAAT MiSeq
FL_16S_FForward primer for full length 16S sequencing/5AmMC6/GCAGTCGAACATGTAGCTGACTCAGGTCACAGRGTTYGATYMTGGCTCA PacBio
FL_16S_RReverse primer for V4 full length sequencing/5AmMC6/TGGATCACTTGTGCAAGCATCACATCGTAGRGYTACCTTGTTACGACTT PacBio
SR_GyrB_Bac_FOrginal short read forward primer to amplify the gyrB gene from Bacteroidaceae TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGGAGGTAARTTCGAYAAAGG MiSeq
SR_GyrB_Bac_ROrginal short read reverse primer to amplify the gyrB gene from Bacteroidaceae GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCRTATTTYTTCARHGTACGG MiSeq
SR_GyrB_Bif_FOrginal short read forward primer to amplify the gyrB gene from Bifidobacteriaceae TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGACRACGGNCGNGGCATYCC MiSeq
SR_GyrB_Bif_ROrginal short read reverse primer to amplify the gyrB gene from Bifidobacteriaceae GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGNCCCTTGTTNAGGAAVGCC MiSeq
SR_GyrB_Lac_FOrginal short read forward primer to amplify the gyrB gene from Lachnospiraceae TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGHGGAGGATAYAAGGTATCC MiSeq
SR_GyrB_Lac_ROrginal short read reverse primer to amplify the gyrB gene from Lachnospiraceae GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTRTANGAATCRTTRTGCTGC MiSeq
LR_GyrB_Bac_FLong read forward primer to amplify the gyrB gene from Bacteroidaceae /5AmMC6/GCAGTCGAACATGTAGCTGACTCAGGTCAC TGTAYATYGGTGACATYAGYRPacBio
LR_GyrB_Bac_RLong read reverse primer to amplify the gyrB gene from Bacteroidaceae /5AmMC6/TGGATCACTTGTGCAAGCATCACATCGTAG CCCATYARCATRGARAAGATRPacBio
LR_GyrB_Bif_FLong read forward primer to amplify the gyrB gene from Bifidobacteriaceae /5AmMC6/GCAGTCGAACATGTAGCTGACTCAGGTCAC ATCGARGTSACGATTCTGCCGPacBio
LR_GyrB_Bif_RLong read reverse primer to amplify the gyrB gene from Bifidobacteriaceae /5AmMC6/TGGATCACTTGTGCAAGCATCACATCGTAG GGATCCATGGTGGTYTCCCACPacBio
LR_GyrB_Lac_FLong read forward primer to amplify the gyrB gene from Lachnospiraceae /5AmMC6/GCAGTCGAACATGTAGCTGACTCAGGTCAC SAGRGGWCTBCATCATYTRGTPacBio
LR_GyrB_Lac_RLong read reverse primer to amplify the gyrB gene from Lachnospiraceae /5AmMC6/TGGATCACTTGTGCAAGCATCACATCGTAG TCMGGATCCATDGTBGTCTCCPacBio
This is a table for all primers used in this project. The first column is the primer name. The second column is the primer description. The third is the primer sequence with the added illumina or PacBio adaptor. The fourth column is what system the primer is used fro, either MiSeq or PacBio.




Before start
Before starting make sure to have isolated bacterial DNA and selected primers for amplification.
Prepare DNA for Amplification
Thaw the isolated DNA

Measure DNA concentration on the Nanodrop

This requires only 1 µL of isolated DNA. Concentration values typically range from 100 ng/μl to 400 ng/μl . In addition, the NanoDrop gives only an estimate of the total DNA concentration. For a more accurate result, submit samples for quantification on a Bioanalyzer.

Create a 100 μl aliquot at 10 ng/μl concentration.


Figure out how much DNA to add by dividing 1000 by the average DNA concentration.

For example: if your average DNA concentration was 254 ng/μl you would take 1000/254 which equals 3.94. So we would use 3.94 µL for the aliquot.

Figure out how much nuclease-free water to add by subtracting the result of step 3.1 from 100.

So to continue the example it would be 100 - 3.94 which equals 96.06. So we would add 3.94 µL of original DNA to 96.06 µL of nuclease-free water. This results in a 10 ng/μl Bacterial DNA solution.

16S and gyrB PacBio and Illumina Amplicon PCR Protocol from Nichols et al.
Prepare the following PCR mix.

ABC
Reagent ConcentrationVolume to make 20 uL of product
Forward primer10 μM0.4 μl
Reverse primer10 μM0.4 μl
Platinum SuperFi Master MixN/A10 μl
Nuclease Free water N/A8.2 μl
This is for each well so multiply each volume by the number of samples plus one or two, to make sure enough master mix is available for all tubes. For example if I was running a 15 sample PCR I would multiply each volume product by 17 (15 samples + 2 extra)

Fill an adequate number of wells with 19 µL of master mix each

Add 1 µL of 10 ng/μl DNA directly into the master mix of each appropriate well

It helps to watch the DNA go into the master mix to ensure that the DNA has been added.

Make sure the reagents are mixed in the PCR tubes by gently flicking and then quickly spinning in a mini centrifuge.
Run PCR
If amplifying 16S samples for MiSeq use these PCR settings.


ABCD
Cycle NumberTimeTemperature Description
1 cycle 2 minutes 98°Cinitial denaturation
25 cycles 10 seconds 98°Cdenaturation
20 seconds 56.6°Cannealing
15 seconds 72°Cextension
1 cycle 5 minutes 72°Cfinal extension
It should be noted that the higher the number of cycles the greater chance for chimeric sequences. The user should optimize PCR cycles to their specifications


If amplifying 16S samples for PacBio use these PCR settings.


ABCD
Cycle NumberTimeTemperature Description
1 cycle 30 seconds 95°Cinitial denaturation
25 cycles 30 seconds95°Cdenaturation
30 seconds 57°Cannealing
1 minute72°Cextension
1 cycle 5 minutes 72°Cfinal extension
It should be noted that the higher the number of cycles the greater chance for chimeric sequences. The user should optimize PCR cycles to their specifications

If amplifying bacterial gyrB samples for MiSeq use these PCR settings.


ABCD
Cycle NumberTimeTemperature Description
1 cycle 2 minutes 98°Cinitial denaturation
30 cycles 10 seconds 98°Cdenaturation
20 seconds 56.6°Cannealing
15 seconds 72°Cextension
1 cycle 5 minutes 72°Cfinal extension
It should be noted that the higher the number of cycles the greater chance for chimeric sequences. The user should optimize PCR cycles to their specifications



If amplifying bacterial gyrB samples for PacBio use these PCR settings.


ABCD
Cycle NumberTimeTemperature Description
1 cycle 30 seconds 95°Cinitial denaturation
30 cycles 30 seconds95°Cdenaturation
30 seconds 57°Cannealing
1 minute72°Cextension
1 cycle 5 minutes 72°Cfinal extension
It should be noted that the higher the number of cycles the greater chance for chimeric sequences. The user should optimize PCR cycles to their specifications


Check for Amplification
Create a 1x agarose gel

This is made by combining 1 g of agarose and 100 mL of 1x TAE. Microwave this solution for 1 minute and 45 seconds. Pour into a mold with an appropriate comb. Add 10 µL of Gel Red dye (at 10,000x). Let this cool for 45 minutes to an hour.

Prep the amplicons for gel electrophoresis

First, prep the dye master mix as follows:

ABC
ReagentConcentrationVolume
Gel loading dye6x8 μl
Nuclease-free water NA16 μl
Make sure to multiply the volumes by the number of samples

Then add in all 20 µL of amplified product to a well containing 24 µL of the dye water mixture.

Run the gel to check for amplification

Add in all of the amplicon sample + dye + water mixture the wells of the submerged gel. Run the gel at 80 volts for 1 hour.

Check the gel in a geldoc to see amplified bands.
Clean the amplicon samples with a gel clean up kit
Cut out the appropriate bands from the gel from step 9

It is easiest to use specialized pipette tips to punch out the appropriate bands. Also, this needs to be completed under UV light so be sure to wear propper PPE.
Use the QIAquick Gel Extraction Kit to clean up gel punch-outs

Briefly, dissolve the gel punch-outs in the provided buffer at 50°C for 10 minutes. Then add the dissolved punch-out mixture to the provided columns. Wash twice with the provided wash buffers and elute with either nuclease-free water or elution buffer (not provided).
Submit samples for sequencing

MiSeq samples were run on a 250x250 Illumina Miseq

PacBio samples were run on a PacBio Sequel II