Jun 20, 2024

Public workspace12S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method

DOI
dx.doi.org/10.17504/protocols.io.4r3l2q9k3l1y/v1
  • 1University of British Columbia
  • Pelagic Ecosystems Lab
    Tech. support email: a.novotny@oceans.ubc.ca
Andreas Novotny
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.4r3l2q9k3l1y/v1
External link: https://hakai.org
Protocol Citation: Andreas Novotny 2024. 12S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2q9k3l1y/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 14, 2024
Last Modified: June 20, 2024
Protocol Integer ID: 101867
Abstract
This protocol is used for eDNA metabarcoding of the mitochondrial 12S rRNA gene (Miya et al 2015) using Pair-End Illumina Miseq Sequencing. This protocol was implemented as part of the Urban Ocean Biodiversity project, a collaboration between the University of British Columbia's Institute for the Oceans and Fisheries, and Tsleil-Waututh First Nation. This protocol is developed to give a species-level resolution of fish diversity.
Guidelines
MIOP: Minimum Information about an Omics Protocol
MIOP TermValue
analysesAmplicon Sequencing, 12S
audiencescientists
broad-scale environmental contextmarine biome ENVO_00000447
creatorAndreas Novotny
environmental mediumsea water [ENVO:00002149]
geographic locationNorth Pacific Ocean [GAZ:00002410]
hasVersion1
issued2024
languageen
licenseCC BY 4.0
local environmental contextcoastal sea water [ENVO: 00002150]
materials requiredSterile workbench, Thermo Cykler, MiSeq, Gel Electrophoresis syste, Qbit, Bioanalyzer
maturity levelMature
methodology categoryOmics Analysis
personnel required1
projectUrban Ocean Biodiversity
publisherUniversity of British Columbia, Pelagic Ecosystems Lab.
purposeDNA metabarcoding
skills requiredsterile technique | pipetting skills
targetFish mitocondrial DNA
time required3-5 days
AUTHORS
PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.AFFILIATIONORCID (visit https://orcid.org/ to register)DATE
Rute CarvalhoHakai Institutehttps://orcid.org/0000-0001-6922-94182024
Colleen KelloggHakai Institutehttps://orcid.org/0000-0001-6922-94182024
Matt LemayHakai Institutehttps://orcid.org/0000-0001-7051-00202024
Andreas NovotnyUniversity of British Columbiahttps://orcid.org/0000-0001-8910-61832024
RELATED PROTOCOLS
PROTOCOL NAME AND LINKISSUER / AUTHORRELEASE DATE This is the date corresponding to the version listed to the left
Content CellContent Cellyyyy-mm-dd
Content CellContent Cellyyyy-mm-dd
This is a list of other protocols which should be known to users of this protocol. Please include the link to each related protocol.
ACRONYMS AND ABBREVIATIONS

ACRONYM / ABBREVIATIONDEFINITION
Content CellContent Cell

GLOSSARY

SPECIALISED TERMDEFINITION
Content CellContent Cell
Content CellContent Cell

BACKGROUND This protocol is used for eDNA metabarcoding of the mitochondrial 12S rRNA gene (Miya et al 2015) using Pair-End Illumina MiseqSequencing.
CITATION
M. Miya , Y. Sato , T. Fukunaga , T. Sado , J. Y. Poulsen , K. Sato , T. Minamoto , S. Yamamoto , H. Yamanaka , H. Araki , M. Kondoh and W. Iwasaki (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. R. Soc. Open Sci..
LINK
https://doi.org/10.1098/rsos.150088
The protocol builds on the Hakai Institutes protocol for 12S metabarcoding, but the bead cleanup protocol have been updated for a more efficient cleanup, for the smaller 12S fragment. More specifically, a sample-to-bead ratio of 1.2 or 1.5 instead of 0.8. See the parent protocol here:
Protocol
12S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method
NAME
12S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method
CREATED BY
Andreas Novotny
Method description and rationale Assuming extracted DNA as starting material, this protocol includes the following steps:

  1. First PCR: Triplicate locus-specific amplification of the mitochondrial 12S rRNA gene (Miya et al 2015) .
  2. First PCR product purification (using magnetic beads)
  3. Second PCR: Sample indexing using Nextera V2 indexing primers
  4. Second PCR product purification (using magnetic beads)
  5. Quantification and Pooling
  6. Library concentration (using magnetic beads)
  7. Gel purification with size selection
  8. Quality control
  9. Pair End Sequencing on Illumina MiSeq V3 2*300 bp

Due to the risk of cross contamination, it is pivotal to separate work with amplified PCR products from pre-PCR steps. We preform pre-PCR steps (including DNA extractions) in separate clean rooms on surfaces steralized with hydrogen peroxide (PreEmpt) and UV.
Spatial coverage and environment(s) of relevance This protocol was implemented as part of the Urban Ocean Bioidiversity project, a collaboration between University of British Columbias Institute for the Oceans and Fisheries, and Tsleil-Waututh First Nation. In 2023 we sambled multiple stations in the Burrard Inlet BC, Canada (from Point Grey to Port Moody Arm, Including the Port of Vancouver). This protocol is developed to give a species-level resolution of fish diversity. Personnel Required 1 Technician
Safety Identify hazards associated with the procedure and specify protective equipment and safety training required to safely execute the procedure!
Training requirements Serile work technique, pipetting skills, PCR, gel electrophoresis.
Time needed to execute the procedure This protocol will take several days to complete depending on sample size.
Materials
Equipment
  • pre-PCR and post-PCR separated workspaces
  • Thermocycler (1 or 3)
  • Gel electrophoresis equipment
  • Qubit or plate reader
  • Magnetic plate
  • BioAnalyzer
  • Real-Time PCR
  • Illumina MiSeq
Protocol materials
ReagentPlatinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
ReagentGel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
ReagentPlatinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
ReagentGel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
ReagentQubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853
ReagentQuant-iT dsDNA Pico Green assay kit (Invitrogen)Life TechnologiesCatalog #P7589
ReagentQubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854
ReagentBioanalyzer chips and reagents (DNA 1000)Agilent TechnologiesCatalog #5067-1504
ReagentMiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001
ReagentPhiX Control v3Illumina, Inc.Catalog #FC-110-3001
ReagentTBE Buffer, 10X Molecular Biology Grade, 1000mlPromegaCatalog #V4251
ReagentRedSafe Nucleic Acid Staining SolutionFroggabioCatalog #21141
ReagentWizard® SV Gel and PCR Clean-Up SystemPromegaCatalog #A9281
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
ReagentNEBNext Library Quant Kit for Illumina - 100 rxnsNew England BiolabsCatalog #E7630S
Before start
Read Minimum Information about an Omics Protocol (MIOP) and other recommendations under the "Guidelines" tab.
Preparations
Preparations
Ensure that the laboratory is appropriately configured and that staff has appropriate training. See "Guidelines" for more information. Pay attention to the separation of pre and post-PCR spaces and equipment.

Critical
Ensure that all reagents are aliquoted in appropriate amounts, and stored according to manufacturers' recommendations. Never pipet directly from reagent stocks.
Prepare the SPRI beads' working solution, and test their efficiency following this protocol.
Protocol
Serapure Beads Preparation and Testing
NAME
Serapure Beads Preparation and Testing
CREATED BY
Andreas Novotny

Prepare primer working stocks (10μM) for both the first and second PCR steps. Here we use Nextera V2 Kit Sets A, B, C, and D. We advise preparing the indexing primers on 96-well plates according to this configuration:
Download Indexes_plate.xlsxIndexes_plate.xlsx38KB
We advise adding aliquots of the extracted DNA to a 96-Well PCR plate to facilitate the setup of the PCR reaction. This metadata template will help keep track of the samples, and if indexes are configured as described above, also the identity of sample indexes.
Triplicate PCR Amplification (1st PCR)
Triplicate PCR Amplification (1st PCR)
Preparations

Note
  1. Prepare PCR reactions in a clean working space (such as a biosafety cabinet) dedicated to pre-PCR tasks only.
  2. Do not need to Qubit DNA samples before starting, only do it if the reaction does not work. 
  3. Use UNDILUTED DNA
  4. Test at least 8 samples before doing a batch/plate. 
  5. Include a negative control, an extraction blank (if you have it), and a positive control. 
  6. After testing, perform the PCR for all of the samples in triplicates.

Reagents:
ReagentMolecular Biology Grade WaterCorningCatalog #46-000-CV (Or equal)
ReagentPlatinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050
ReagentFroggarose LEFroggabioCatalog #A87-500G (Or equal)
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101 (Or equal)
ReagentGel Red Nucleic Acid Gel StainBiotiumCatalog ##41003 (Or equal)
  • Custom-designed primers (Miya et al 2015) including:
PCR Primer NameDirectionSequence (5’ -> 3’)
MiFish-U-F_overhangforwardTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTCGGTAAAACTCGTGCCAGC
MiFish-U-R_overhangreverseGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAGTGGGGTATCTAATCCCAGTTTG

Wash
UV for 30 minutes the following:  
  • 96-well PCR plates (or 8-strip tubes)  
  • Sharpie 
  • Pipette tips 
  • Multichannel pipettes  
  • Pipettes  
  • Sterile Nuclease-Free Water

Thaw Platinum, Primers, and nuclease-free water. Keep them in a cooling microcentrifuge tube rack.
PCR reactions are carried out in triplicate 12.5 μl reactions:
ReagentVolume (μl)
Sterile Nuclease-Free water3.65
Forward primer (10μM)0.3
Reverse Primer (10μM)0.3
Platinum SuperFi6.25
DNA (1-10 ng)2
TOTAL12.5

30m
Pipetting
Seal the 96-well plates and transfer them to thermocyclers.

Note
Amplified PCR products should never come in contact with equipment used for non-amplified DNA.
From this point, no samples will reenter the pre-PCR working space.
PCR stepTemperatureDurationRepetition
denaturation94°C3 minutes
denaturation94°C30 seconds
annealing63°C30 seconds
extension68°C30 seconds
GO TO step 239 times
final extension68°C10 minutes
HOLD12°CHOLD

2h
PCR
Critical
Pool the three replicates.
Run sample pools on a 2% gel (90V, ~40-60 min) to check the size
of the amplicons and the success of the PCR (5μl/sample).

Expected result
You may see 2 amplified fragments: one ~ 300 bp, and other one ~400 bp. The target band is ~300 bp, do not worry if you see two bands, because we will eliminate the larger one at the
end of the library prep.

1h
Analyze
Pause
Purification of first PCR product using SPRI beads
Purification of first PCR product using SPRI beads
Preparations
Note
Prepare the purification in the post-PCR working space.

Size selection can be achieved using different ratios of magnetic beads to sample. A rate of bead to a sample of 1.2 will efficiently purify the amplicons away from primer dimers and allow the selection of fragments larger than 200 bp. (Note, this is a higher ratio than for 18S and COI, as the fragment is smaller).

Materials  
  • Serapure SPRI beads. If not already prepared: Go to
  • Magnetic 96-well plate stand 
  • Anhydrous Ethanol to make a fresh 80% ethanol solution 
  • Molecular grade water  

UV for 30 minutes the following:  
  • 96-well PCR plates (or 8-strip tubes)  
  • Sharpie 
  • Pipette tips 
  • Multichannel pipettes  
  • Pipettes  
  • Sterile Nuclease-Free Water

Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
  • Vortex the beads before use.
  • As you now have about 32.5μl reaction (pooled samples - 5μl used on a gel/Qiaxcel), add 39 μl beads to the product to obtain a ratio of 1.2.
  • Pipette up and down about ten times (or until the solution is well mixed – you will see that the color changes).
  • Spin tubes down to remove drops from the walls.
  • Incubate a room temperature without shaking for 5 min. For samples that you know have a low DNA concentration, you can increase this incubation time to 30 min.
  • Place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).
8m
Remove the supernatant with a multichannel pipette, ensuring to not disturb the beads.
5m
With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol and incubate for 30s. Carefully remove the supernatant without disturbing the beads.
10m
Repeat the washing step Go togo to step #16
10m
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*).

Note
*This depends on the type of the magnetic rack – the O-ring magnet dries faster than the side magnet. Keep an eye on the beads and do not over-dry. Otherwise, you will not get an efficient DNA recovery.

5m
Critical
 Remove the plate from the magnetic stand and add 32 μl of nuclease-free water for elution. Gently pipet up and down ten times to resuspend the beads.  Incubate the plate at room temperature for 5 min.
5m
Place the plate back on the magnetic rack for at least 5 min or until the supernatant is cleared. 
5m
Carefully transfer 30 μl of the clear supernatant to a new plate. Seal the plate.
Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date,  Initials.
Samples can be stored at -20°C for up to 7 days.
Pause
Indexing PCR amplification (2nd PCR)
Indexing PCR amplification (2nd PCR)
Preparations

Reagents:
ReagentPlatinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050
ReagentMolecular Biology Grade WaterCorningCatalog #46-000-CV
ReagentFroggarose LEFroggabioCatalog #A87-500G
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
ReagentGel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
  • i5 and i7 index plates (10 μM) – If not already prepared: Go togo to step #4
PCR Primer NameDirectionSequence (5’ -> 3’)
Nextera V2 Index1forwardCAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Nextera V2 Index 2reverseAATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
UV for 30 minutes the following:  
- 96-well PCR plates (or 8-strip tubes)  
- Sharpie 
- Pipette tips 
- Multichannel pipettes  
- Pipettes  
- Sterile Nuclease-Free Water

Thaw Taq, i5 and i7 indexes, and nuclease-free water. Keep them in the  IsoFreeze microcentrifuge tube rack.

Prepare PCR reaction in 25μl reactions:
ReagentVolume (μl)
Sterile Nuclease-Free water5
Forward primer (10μM)2.5
Reverse Primer (10μM)2.5
2XTaq12.5
DNA (1-10 ng)2.5
TOTAL25

Seal the 96-well plates and transfer them to thermocyclers.
PCR stepTemperatureDurationRepetition
denaturation94°C3 minutes
denaturation94°C30 seconds
annealing55°C30 seconds
extension68°C30 seconds
GO TO step 27X
final extension68°C5 minutes
HOLD12°CHOLD
PCR
Run the product on a 2% agarose gel to check the size of the amplicons and success of the PCR (5μl).

Note
Again, you may see two bands (~350bp and ~450bp).

Pause
Purification of indexed libraries (Second bead cleanup)
Purification of indexed libraries (Second bead cleanup)
Preparations

Materials  
  • Prepared serapure SPRI beads.
  • Magnetic 96-well plate stand 
  • Anhydrous Ethanol to make a fresh 80% ethanol solution 
  • Molecular grade water  

UV for 30 minutes the following:  
  • 96-well PCR plates (or 8-strip tubes)  
  • Sharpie 
  • Pipette tips 
  • Multichannel pipettes  
  • Pipettes  
  • Sterile Nuclease-Free Water

Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
  • Vortex the beads before use.
  • Add 24 μl beads to 20 μl of PCR product to obtain a ratio of 1.2.
  • Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes).
  • Spin tubes down to remove drops from the walls.
  • Incubate a room temperature without shaking for 5 min. For samples that you know have a low DNA concentration, you can increase this incubation time to 30 min.
  • Place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).
Remove the supernatant with a multichannel pipette, making sure not to disturb
the beads.
  • With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol.
  • Incubate for 30 s.
  • Carefully remove the supernatant without disturbing the beads.
Repeat the washing step. Go togo to step #31
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*). Keep an eye on the beads and do not over-dry, otherwise, you will not get an efficient DNA recovery.
Note
*the length of time depends on the type of the magnetic rack – the O-ring magnet
dries faster than the side magnet.

  • Remove the plate from the magnetic stand and add 28 μl of nuclease-free water for elution.
  • Gently pipette up and down ten times to resuspend the beads.
  • Incubate the plate at room temperature for 5 min.
Place the plate back on the magnetic rack for at least 5 min or until the supernatant has cleared.
Carefully transfer 25 μl of the clear supernatant to a new plate. Seal the plate.
Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date,  Initials.
Samples can be stored at -20°C for up to 7 days.
Pause
Quantification and pooling, and quality control
Quantification and pooling, and quality control
Use a fluorometric quantification method that uses dsDNA dyes to measure the concentration of your libraries (Qubit or plate reader). If using Qubit, give preference to the broad range kit if you visualize a strong band in the gel:ReagentQubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853 OR
ReagentQuant-iT dsDNA Pico Green assay kit (Invitrogen)Life TechnologiesCatalog #P7589

Expected result
Samples will have approximately similar concentrations (usually). Re-check samples that showed very high or low concentrations on Qubit/plate reader quantification. 

Calculate sample volume to have a final amount of 10-40 ng. This amount may vary depending on the overall quantification. For example, if on average the concentration of your samples is about 3 ng/μl and you have 20 μl of product,  you can calculate the volume to make up to 60 ng per sample.

Note
Check the final volume that you will get after pooling – sometimes you will end up with 2 mL or more. Then use the proper Eppendorf tube for pooling (1.5, 2.0, or 5 mL).

Measure the final library pool concentration on Qubit using
ReagentQubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854

Label tube: [Gene_name], [Project_Name], Pooled Amplicons. Date, Initials, pool concentration.
Concentrating library pool with magnetic beads
Concentrating library pool with magnetic beads

Note
You may need to perform an extra beads purification step to decrease the volume of your pool. For example, if you ended up with 2 mL pool you won’t be able to load this volume in the gel in the next step of the library prep. So, decreasing the volume to 40-50 μl is necessary at this point.

Since the purpose of this protocol is to concentrate the library, not selecting the size, we increase the bead-to-sample ratio to 1.5 to get maximum DNA recovery.

Materials
  • Magnetic beads* (SPRI beads or AMpure XP, find aliquots in fridge)
  • Magnetic rack for 1.5-2 mL tubes
  • Anhydrous Ethanol to make a fresh 80% ethanol solution
  • Sterile Nuclease-Free water
UV for 30 minutes the following:
  • 1.5 mL lo-Bind tubes
  • Sharpie
  • Pipette tips
  • Pipettes
  • Sterile Nuclease-Free Water

Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
Aliquot your pool into 1.5 mL tubes (try to keep similar volumes between aliquots, a maximum of 350 μl per tube). If you have a 2 mL pool, you can aliquot 350 μl pool in 5 tubes, and have the 6th tube with 250 μl.
Calculate the volume of beads to add into each tube (1.5 x beads). For the tubes with 300 μl – add 450 μl beads, and for the tube with 200 μl, add 300 μl beads. You will obtain a ratio of 1.5. Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes). Spin tubes down to remove drops from the walls. Incubate a room temperature without shaking for 5 min.
Place the tubes on the magnetic rack until the supernatant has cleared (~ 3 min).
Remove the supernatant with a P1000 pipette, making sure not to disturb the beads.
With the samples on the magnetic rack, wash the beads by adding 500 μl of freshly prepared 80% ethanol and incubate for 30 s. Carefully remove the supernatant without disturbing the beads.
Repeat washing step Go togo to step #47

Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic rack (~ 5 min*). Keep an eye on the beads and do not over dry, otherwise you will not get an efficient DNA recovery.
Note
This length of time may vary. It is important to keep an eye on the beads (they must look opaque).

Remove the tubes from the magnetic rack and add 40 μl of nuclease-free water for elution. Gently pipette up and down ten times to resuspend the beads. Incubate the tubes at room temperature for 5 min.
Place the tubes back on the magnetic rack at least 5 min or until the supernatant is cleared.
Carefully transfer 30 μl of the clear supernatant to a single new tube (pooling the volumes of the 6 tubes).
Repeat the bead cleanup to reduce the volume even more. You may now have 180 μl in your pool, so you must add 270 μl of beads to have a rate of 1.5. Go togo to step #44
Make final elution in 50 μl of water, transferring 45 μl of the clear supernatant to a new tube.
Name the tube: [Gene_name], Project, Concentrated Pool, Date, Initials.
Gel purification with size selection
Gel purification with size selection

Note
This preparation may take 2 days. Allow enough time for autoclaving the buffer, preparing, and purifying the gel. There are some safe stopping points if you do not have two days in a row available to perform this procedure.


Materials:
ReagentTBE Buffer, 10X Molecular Biology Grade, 1000mlPromegaCatalog #V4251 (or similar)
ReagentFroggarose LEFroggabioCatalog #A87-500G
ReagentRedSafe Nucleic Acid Staining SolutionFroggabioCatalog #21141
ReagentWizard® SV Gel and PCR Clean-Up SystemPromegaCatalog #A9281
Reagent100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101

Prepare 1.5-2 L of 1x TBE buffer and autoclave it. Wait for it cool down to room
temperature. *safe stopping point.
Prepare a 3% agarose gel. It may polymerize faster that the gels that you are used to prepare. You may need about 120 mL of buffer and 3.6 g of agarose if using the small electrophoresis system. Add 6 μl of RedSafe. Use a comb with large teeth – it may accommodate a higher volume of product.
If you have 45 μl of product, add 8 μl of loading dye to the tube and mix well. Load the entire tube’s content in the well. You may need more than one well to load the entire content.
Load the Ladder 100 bp in the first and last well (~3 μl).
Run the gel for about 1h at 90V. In this mean time, weigh one 1.5 mL Eppendorf tube and record the weight. Place on your counter: sterile blade for scalpel, a scalpel, and the LED transilluminator.
When the gel run is done, transfer the gel to the transilluminator, and excise the 350 bp band. Place it in the 1.5 mL tube that you have weighed. * Sometimes the stronger band is the non-target one. That’s why it is important to have the ladder running beside your samples to help you to find the right band. See Figure 1.
Figure 1. 12S rRNA libraries loaded in the 3% gel. Ladder (100 bp) was loaded in
the first and last wells. Second and third well has one library loaded (~20 μl in each
well), fourth well is empty, and the fifth and sixth wells have other 12S library
loaded (~20 μl in each well). Note that the strong band has ~450 bp, but this is
not our target!

Weigh the tube with the gel slice. Record the weight.
Use the Promega Wizard SV gel and PCR clean-up to perform the gel purification (follow instructions in the manual - https://www.promega.ca/products/nucleic-acid-extraction/clean-up-and- concentration/wizard-sv-gel-and-pcr-clean-up-system/?catNum=A9281#protocols).
Add 10 μl Membrane Binding Solution per 10 mg of gel slice (for example, if you weight 102 mg of gel slice in the tube, add 102 μl of Membrane Binding Solution).
Vortex and incubate at 50-65oC until gel slice is completely dissolved (~10 min). Vortex again to be sure that you do not have any gel in the tube. Spin down.
Insert SV minicolumn into a collection tube.
Transfer dissolved gel mixture to the minicolumn assembly. Incubate at room temperature for 1 min.
Centrifuge at 16,000 x g for 1 min. Discard flowthrough, and reinsert the minicolumn into thecollection tube. *dry the collection tube edges using Kim wipes if necessary.
Add 700 μl Membrane Wash Solution (ethanol added). Centrifuge at 16,000 x g for 1 min. Discard flowthrough, and reinsert the minicolumn into collection tube.
Repeat the step 15 with 500 μl Membrane Wash Solution. Centrifuge at 16,000 x g for 5 min.
Empty the collection tube and recentrifuged the column assembly for 1 min to allow evaporation of any residual ethanol.
Carefully transfer minicolumn to a clean 1.5 ml tube.
Add 35-50 μl of elution buffer (or Nuclease-Free water) to the minicolumn. Incubate at room temperature for 1 min. Centrifuge at 16,000 x g for 1 min. Perform a second elution if you consider it to be necessary.
Quantify the purified product on Qubit using the ds DNA BR kit.
Label tube: [Gene_name], [Project_Name], Final Library. Date, Initials, concentration.
Sequencing parameters
Sequencing parameters
Library fragment size (BP) is determined using ReagentBioanalyzer chips and reagents (DNA 1000)Agilent TechnologiesCatalog #5067-1504
Molarity of the final pool is assessed using ReagentNEBNext Library Quant Kit for Illumina - 100 rxnsNew England BiolabsCatalog #E7630S
COI libraries are sequenced an a MiSeq instrument using:
ReagentMiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001 with pair-end setup (2*300 bp), spiked with 10% ReagentPhiX Control v3Illumina, Inc.Catalog #FC-110-3001 .

Citations
M. Miya , Y. Sato , T. Fukunaga , T. Sado , J. Y. Poulsen , K. Sato , T. Minamoto , S. Yamamoto , H. Yamanaka , H. Araki , M. Kondoh and W. Iwasaki. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
https://doi.org/10.1098/rsos.150088