License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 01, 2024
Last Modified: June 17, 2024
Protocol Integer ID: 101063
Keywords: mitochondrial 12s rrna gene, level resolution of fish diversity, fish diversity, plankton communities in the northern salish sea, rrna gene, plankton community, end illumina miseq sequencing, biomolecular sample, northern salish sea, fish, part of the hakai institute ocean observing program, pcr method, pcr method this protocol, hakai institute ocean observing program, edna metabarcoding, sequencing, species, pcr
Abstract
This protocol is used for eDNA metabarcoding of the mitochondrial 12S rRNA gene (Miya et al 2015) using Pair-End Illumina Miseq Sequencing. As part of the Hakai Institute Ocean Observing Program, biomolecular samples have been collected weekly, from 0 m to near bottom (260 m), to genetically characterize plankton communities in the Northern Salish Sea since 2015. This protocol is developed to give a species-level resolution of fish diversity.
Guidelines
MIOP: Minimum Information about an Omics Protocol
MIOP Term
Value
analyses
Amplicon Sequencing, 12S
audience
scientists
broad-scale environmental context
marine biome ENVO_00000447
creator
Rute Carvalho
environmental medium
sea water [ENVO:00002149]
geographic location
North Pacific Ocean [GAZ:00002410]
hasVersion
1
issued
2024
language
en
license
CC BY 4.0
local environmental context
coastal sea water [ENVO: 00002150]
materials required
Sterile workbench, Thermo Cykler, MiSeq, Gel Electrophoresis syste, Qbit, Bioanalyzer
maturity level
Mature
methodology category
Omics Analysis
personnel required
1
project
Biomolecular surveys of marine biodiversity in the Northern Salish Sea, BC
publisher
Hakai Institute, Ocean Observing Program
purpose
DNA metabarcoding
skills required
sterile technique | pipetting skills
target
Fish mitocondrial DNA
time required
3-5 days
AUTHORS
PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.
AFFILIATION
ORCID (visit https://orcid.org/ to register)
DATE
Rute Carvalho
Hakai Institute
https://orcid.org/0000-0001-6922-9418
2024
Colleen Kellogg
Hakai Institute
https://orcid.org/0000-0001-6922-9418
2024
Matt Lemay
Hakai Institute
https://orcid.org/0000-0001-7051-0020
2024
RELATED PROTOCOLS
PROTOCOL NAME AND LINK
ISSUER / AUTHOR
RELEASE DATE This is the date corresponding to the version listed to the left
Content Cell
Content Cell
yyyy-mm-dd
Content Cell
Content Cell
yyyy-mm-dd
This is a list of other protocols which should be known to users of this protocol. Please include the link to each related protocol.
ACRONYMS AND ABBREVIATIONS
ACRONYM / ABBREVIATION
DEFINITION
Content Cell
Content Cell
GLOSSARY
SPECIALISED TERM
DEFINITION
Content Cell
Content Cell
Content Cell
Content Cell
BACKGROUND
This protocol is used for eDNA metabarcoding of the mitochondrial 12S rRNA gene (Miya et al 2015) using Pair-End Illumina MiseqSequencing.
Citation
M. Miya , Y. Sato , T. Fukunaga , T. Sado , J. Y. Poulsen , K. Sato , T. Minamoto , S. Yamamoto , H. Yamanaka , H. Araki , M. Kondoh and W. Iwasaki (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. R. Soc. Open Sci..
Method description and rationale
Assuming extracted DNA as starting material, this protocol includes the following steps:
First PCR: Triplicate locus-specific amplification of the mitochondrial 12S rRNA gene (Miya et al 2015) .
First PCR product purification (using magnetic beads)
Second PCR: Sample indexing using Nextera V2 indexing primers
Second PCR product purification (using magnetic beads)
Quantification and Pooling
Library concentration (using magnetic beads)
Gel purification with size selection
Quality control
Pair End Sequencing on Illumina MiSeq V3 2*300 bp
Due to the risk of cross contamination, it is pivotal to separate work with amplified PCR products from pre-PCR steps. We preform pre-PCR steps (including DNA extractions) in separate clean rooms on surfaces steralized with hydrogen peroxide (PreEmpt) and UV.
Spatial coverage and environment(s) of relevance
As part of the Hakai Institute Ocean Observing Program, biomolecular samples have been collected weekly, from 0 to near bottom (260 m), to genetically characterize plankton communities in the Northern Salish Sea since 2015, developing a climatology from which we can begin uncover the physical, chemical and biological drivers of community and functional change in the dynamic coastal waters of coastal British Columbia. This protocol is developed to give a species-level resolution of fish diversity.Personnel Required
1 Technician
Safety
Identify hazards associated with the procedure and specify protective equipment and safety training required to safely execute the procedure!
Training requirements
Serile work technique, pipetting skills, PCR, gel electrophoresis.
Time needed to execute the procedure
This protocol will take several days to complete depending on sample size.
Read Minimum Information about an Omics Protocol (MIOP) and other recommendations under the "Guidelines" tab.
Preparations
Ensure that the laboratory is appropriately configured and that staff has appropriate training. See "Guidelines" for more information. Pay attention to the separation of pre and post-PCR spaces and equipment.
Ensure that all reagents are aliquoted in appropriate amounts, and stored according to manufacturers' recommendations. Never pipet directly from reagent stocks.
Prepare the SPRI beads' working solution, and test their efficiency following this protocol.
Prepare primer working stocks (10μM) for both the first and second PCR steps. Here we use Nextera V2 Kit Sets A, B, C, and D. We advise preparing the indexing primers on 96-well plates according to this configuration:
Indexes_plate.xlsx38.5KB
We advise adding aliquots of the extracted DNA to a 96-Well PCR plate to facilitate the setup of the PCR reaction. This metadata template will help keep track of the samples, and if indexes are configured as described above, also the identity of sample indexes.
Triplicate PCR Amplification (1st PCR)
Preparations
Note
Prepare PCR reactions in a clean working space (such as a biosafety cabinet) dedicated to pre-PCR tasks only.
Do not need to Qubit DNA samples before starting, only do it if the reaction does not work.
Use UNDILUTED DNA
Test at least 8 samples before doing a batch/plate.
Include a negative control, an extraction blank (if you have it), and a positive control.
After testing, perform the PCR for all of the samples in triplicates.
Thaw Platinum, Primers, and nuclease-free water. Keep them in a cooling microcentrifuge tube rack.
PCR reactions are carried out in triplicate 12.5 μl reactions:
Reagent
Volume (μl)
Sterile Nuclease-Free water
3.65
Forward primer (10μM)
0.3
Reverse Primer (10μM)
0.3
Platinum SuperFi
6.25
DNA (1-10 ng)
2
TOTAL
12.5
30m
Seal the 96-well plates and transfer them to thermocyclers.
Note
Amplified PCR products should never come in contact with equipment used for non-amplified DNA.
From this point, no samples will reenter the pre-PCR working space.
PCR step
Temperature
Duration
Repetition
denaturation
94°C
3 minutes
denaturation
94°C
30 seconds
annealing
63°C
30 seconds
extension
68°C
30 seconds
GO TO step 2
39 times
final extension
68°C
10 minutes
HOLD
12°C
HOLD
2h
Pool the three replicates.
Run sample pools on a 2% gel (90V, ~40-60 min) to check the size
of the amplicons and the success of the PCR (5μl/sample).
Expected result
You may see 2 amplified fragments: one ~ 300 bp, and other one ~400 bp. The target band is ~300 bp, do not worry if you see two bands, because we will eliminate the larger one at the
end of the library prep.
1h
Purification of first PCR product using SPRI beads
Preparations
Note
Prepare the purification in the post-PCR working space.
Size selection can be achieved using different ratios of magnetic beads to sample. A rate of bead to a sample of 0.8-1.5 will efficiently purify the amplicons away from primer dimers and allow the selection of fragments larger than 200 bp.
Materials
Serapure SPRI beads. If not already prepared:
Magnetic 96-well plate stand
Anhydrous Ethanol to make a fresh 80% ethanol solution
Molecular grade water
UV for 30 minutes the following:
96-well PCR plates (or 8-strip tubes)
Sharpie
Pipette tips
Multichannel pipettes
Pipettes
Sterile Nuclease-Free Water
Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
Vortex the beads before use.
As you now have about 32.5μl reaction (pooled samples - 5μl used on a gel/Qiaxcel), add 26 μl beads to the product to obtain a ratio of 0.8.
Pipette up and down about ten times (or until the solution is well mixed – you will see that the color changes).
Spin tubes down to remove drops from the walls.
Incubate a room temperature without shaking for 5 min. For samples that you know have a low DNA concentration, you can increase this incubation time to 30 min.
Place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).
8m
Remove the supernatant with a multichannel pipette, ensuring to not disturb the beads.
5m
With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol and incubate for 30s. Carefully remove the supernatant without disturbing the beads.
10m
Repeat the washing step
10m
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*).
Note
*This depends on the type of the magnetic rack – the O-ring magnet dries faster than the side magnet. Keep an eye on the beads and do not over-dry. Otherwise, you will not get an efficient DNA recovery.
5m
Remove the plate from the magnetic stand and add 32 μl of nuclease-free water for elution. Gently pipet up and down ten times to resuspend the beads. Incubate the plate at room temperature for 5 min.
5m
Place the plate back on the magnetic rack for at least 5 min or until the supernatant is cleared.
5m
Carefully transfer 30 μl of the clear supernatant to a new plate. Seal the plate.
Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date, Initials.
Samples can be stored at -20°C for up to 7 days.
Indexing PCR amplification (2nd PCR)
Preparations
Reagents:
Platinum™ SuperFi II PCR Master MixInvitrogen - Thermo FisherCatalog #12368050
100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
Gel Red Nucleic Acid Gel StainBiotiumCatalog ##41003
i5 and i7 index plates (10 μM) – If not already prepared:
PCR Primer Name
Direction
Sequence (5’ -> 3’)
Nextera V2 Index1
forward
CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Nextera V2 Index 2
reverse
AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
UV for 30 minutes the following:
- 96-well PCR plates (or 8-strip tubes)
- Sharpie
- Pipette tips
- Multichannel pipettes
- Pipettes
- Sterile Nuclease-Free Water
Thaw Taq, i5 and i7 indexes, and nuclease-free water. Keep them in the IsoFreeze microcentrifuge tube rack.
Prepare PCR reaction in 25μl reactions:
Reagent
Volume (μl)
Sterile Nuclease-Free water
5
Forward primer (10μM)
2.5
Reverse Primer (10μM)
2.5
2XTaq
12.5
DNA (1-10 ng)
2.5
TOTAL
25
Seal the 96-well plates and transfer them to thermocyclers.
PCR step
Temperature
Duration
Repetition
denaturation
94°C
3 minutes
denaturation
94°C
30 seconds
annealing
55°C
30 seconds
extension
68°C
30 seconds
GO TO step 2
7X
final extension
68°C
5 minutes
HOLD
12°C
HOLD
Run the product on a 2% agarose gel to check the size of the amplicons and success of the PCR (5μl).
Note
Again, you may see two bands (~350bp and ~450bp).
Purification of indexed libraries (Second bead cleanup)
Preparations
Materials
Prepared serapure SPRI beads.
Magnetic 96-well plate stand
Anhydrous Ethanol to make a fresh 80% ethanol solution
Molecular grade water
UV for 30 minutes the following:
96-well PCR plates (or 8-strip tubes)
Sharpie
Pipette tips
Multichannel pipettes
Pipettes
Sterile Nuclease-Free Water
Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
Vortex the beads before use.
Add 16 μl beads to 20 μl of PCR product to obtain a ratio of 0.8.
Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes).
Spin tubes down to remove drops from the walls.
Incubate a room temperature without shaking for 5 min. For samples that you know have a low DNA concentration, you can increase this incubation time to 30 min.
Place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).
Remove the supernatant with a multichannel pipette, making sure not to disturb
the beads.
With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol.
Incubate for 30 s.
Carefully remove the supernatant without disturbing the beads.
Repeat the washing step.
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*). Keep an eye on the beads and do not over-dry, otherwise, you will not get an efficient DNA recovery.
Note
*the length of time depends on the type of the magnetic rack – the O-ring magnet
dries faster than the side magnet.
Remove the plate from the magnetic stand and add 28 μl of nuclease-free water for elution.
Gently pipette up and down ten times to resuspend the beads.
Incubate the plate at room temperature for 5 min.
Place the plate back on the magnetic rack for at least 5 min or until the supernatant has cleared.
Carefully transfer 25 μl of the clear supernatant to a new plate. Seal the plate.
Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date, Initials.
Samples can be stored at -20°C for up to 7 days.
Quantification and pooling, and quality control
Use a fluorometric quantification method that uses dsDNA dyes to measure the concentration of your libraries (Qubit or plate reader). If using Qubit, give preference to the broad range kit if you visualize a strong band in the gel:Qubit dsDNA Broad Range assay kit (500 assays)Invitrogen - Thermo FisherCatalog #Q32853 OR
Quant-iT dsDNA Pico Green assay kit (Invitrogen)Life TechnologiesCatalog #P7589
Expected result
Samples will have approximately similar concentrations (usually). Re-check samples that showed very high or low concentrations on Qubit/plate reader quantification.
Calculate sample volume to have a final amount of 10-40 ng. This amount may vary depending on the overall quantification. For example, if on average the concentration of your samples is about 3 ng/μl and you have 20 μl of product, you can calculate the volume to make up to 60 ng per sample.
Note
Check the final volume that you will get after pooling – sometimes you will end up with 2 mL or more. Then use the proper Eppendorf tube for pooling (1.5, 2.0, or 5 mL).
Measure the final library pool concentration on Qubit using
Label tube: [Gene_name], [Project_Name], Pooled Amplicons. Date, Initials, pool concentration.
Concentrating library pool with magnetic beads
Note
You may need to perform an extra beads purification step to decrease the volume of your pool. For example, if you ended up with 2 mL pool you won’t be able to load this volume in the gel in the next step of the library prep. So, decreasing the volume to 40-50 μl is necessary at this point.
Materials
Magnetic beads* (SPRI beads or AMpure XP, find aliquots in fridge)
Magnetic rack for 1.5-2 mL tubes
Anhydrous Ethanol to make a fresh 80% ethanol solution
Sterile Nuclease-Free water
UV for 30 minutes the following:
1.5 mL lo-Bind tubes
Sharpie
Pipette tips
Pipettes
Sterile Nuclease-Free Water
Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).
Aliquot your pool into 1.5 mL tubes (try to keep similar volumes between aliquots, a maximum of 350 μl per tube). If you have a 2 mL pool, you can aliquot 350 μl pool in 5 tubes, and have the 6th tube with 250 μl.
Calculate the volume of beads to add into each tube (0.8x beads). For the tubes with 350 μl – add 280 μl beads, and for the tube with 250 μl, add 200 μl beads. You will obtain a ratio of 0.8. Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes). Spin tubes down to remove drops from the walls. Incubate a room temperature without shaking for 5 min.
Place the tubes on the magnetic rack until the supernatant has cleared (~ 3 min).
Remove the supernatant with a P1000 pipette, making sure not to disturb the beads.
With the samples on the magnetic rack, wash the beads by adding 500 μl of freshly prepared 80% ethanol and incubate for 30 s. Carefully remove the supernatant without disturbing the beads.
Repeat washing step
Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic rack (~ 5 min*). Keep an eye on the beads and do not over dry, otherwise you will not get an efficient DNA recovery.
Note
This length of time may vary. It is important to keep an eye on the beads (they must look opaque).
Remove the tubes from the magnetic rack and add 40 μl of nuclease-free water for elution. Gently pipette up and down ten times to resuspend the beads. Incubate the tubes at room temperature for 5 min.
Place the tubes back on the magnetic rack at least 5 min or until the supernatant is cleared.
Carefully transfer 30 μl of the clear supernatant to a single new tube (pooling the volumes of the 6 tubes).
Repeat the bead cleanup to reduce the volume even more. You may now have 180 μl in your pool, so you must add 144 μl of beads to have a rate of 0.8.
Make final elution in 50 μl of water, transferring 45 μl of the clear supernatant to a new tube.
Name the tube: [Gene_name], Project, Concentrated Pool, Date, Initials.
Gel purification with size selection
Note
This preparation may take 2 days. Allow enough time for autoclaving the buffer, preparing, and purifying the gel. There are some safe stopping points if you do not have two days in a row available to perform this procedure.
Wizard® SV Gel and PCR Clean-Up SystemPromegaCatalog #A9281
100bp DNA Ladder, 250ul (50 lanes)PromegaCatalog #G2101
Prepare 1.5-2 L of 1x TBE buffer and autoclave it. Wait for it cool down to room
temperature. *safe stopping point.
Prepare a 3% agarose gel. It may polymerize faster that the gels that you are used to prepare. You may need about 120 mL of buffer and 3.6 g of agarose if using the small electrophoresis system. Add 6 μl of RedSafe. Use a comb with large teeth – it may accommodate a higher volume of product.
If you have 45 μl of product, add 8 μl of loading dye to the tube and mix well. Load the entire tube’s content in the well. You may need more than one well to load the entire content.
Load the Ladder 100 bp in the first and last well (~3 μl).
Run the gel for about 1h at 90V. In this mean time, weigh one 1.5 mL Eppendorf tube and record the weight. Place on your counter: sterile blade for scalpel, a scalpel, and the LED transilluminator.
When the gel run is done, transfer the gel to the transilluminator, and excise the 350 bp band. Place it in the 1.5 mL tube that you have weighed. * Sometimes the stronger band is the non-target one. That’s why it is important to have the ladder running beside your samples to help you to find the right band. See Figure 1.
Figure 1. 12S rRNA libraries loaded in the 3% gel. Ladder (100 bp) was loaded in
the first and last wells. Second and third well has one library loaded (~20 μl in each
well), fourth well is empty, and the fifth and sixth wells have other 12S library
loaded (~20 μl in each well). Note that the strong band has ~450 bp, but this is
not our target!
Weigh the tube with the gel slice. Record the weight.
Use the Promega Wizard SV gel and PCR clean-up to perform the gel purification (follow instructions in the manual - https://www.promega.ca/products/nucleic-acid-extraction/clean-up-and- concentration/wizard-sv-gel-and-pcr-clean-up-system/?catNum=A9281#protocols).
Add 10 μl Membrane Binding Solution per 10 mg of gel slice (for example, if you weight 102 mg of gel slice in the tube, add 102 μl of Membrane Binding Solution).
Vortex and incubate at 50-65oC until gel slice is completely dissolved (~10 min). Vortex again to be sure that you do not have any gel in the tube. Spin down.
Insert SV minicolumn into a collection tube.
Transfer dissolved gel mixture to the minicolumn assembly. Incubate at room temperature for 1 min.
Centrifuge at 16,000 x g for 1 min. Discard flowthrough, and reinsert the minicolumn into thecollection tube. *dry the collection tube edges using Kim wipes if necessary.
Add 700 μl Membrane Wash Solution (ethanol added). Centrifuge at 16,000 x g for 1 min. Discard flowthrough, and reinsert the minicolumn into collection tube.
Repeat the step 15 with 500 μl Membrane Wash Solution. Centrifuge at 16,000 x g for 5 min.
Empty the collection tube and recentrifuged the column assembly for 1 min to allow evaporation of any residual ethanol.
Carefully transfer minicolumn to a clean 1.5 ml tube.
Add 35-50 μl of elution buffer (or Nuclease-Free water) to the minicolumn. Incubate at room temperature for 1 min. Centrifuge at 16,000 x g for 1 min. Perform a second elution if you consider it to be necessary.
Quantify the purified product on Qubit using the ds DNA BR kit.
Label tube: [Gene_name], [Project_Name], Final Library. Date, Initials, concentration.
Sequencing parameters
Library fragment size (BP) is determined using Bioanalyzer chips and reagents (DNA 1000)Agilent TechnologiesCatalog #5067-1504
Molarity of the final pool is assessed using NEBNext Library Quant Kit for Illumina - 100 rxnsNew England BiolabsCatalog #E7630S
COI libraries are sequenced an a MiSeq instrument using:
MiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001 with pair-end setup (2*300 bp), spiked with 10% PhiX Control v3Illumina, Inc.Catalog #FC-110-3001.
Citations
M. Miya , Y. Sato , T. Fukunaga , T. Sado , J. Y. Poulsen , K. Sato , T. Minamoto , S. Yamamoto , H. Yamanaka , H. Araki , M. Kondoh and W. Iwasaki. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species